إعـــــــلان

تقليص

قوانين مختبرات العرب - إطلع عليها قبل أن تشارك -










lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
color:#17365D'>بسم الله الرحمن الرحيم .



أولا - قوانين عامة :






  1. التقيد بالشريعة الإسلامية وعدم
    التعدي على الثوابت والأركان بأي حال وبأي طريقة سواء كانت مباشرة أو غير
    مباشرة.




  2. أن تكون المواضيع المدرجة ذات
    قيمه وأصالة ورقي في الطرح والأسلوب والحوار،
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>وبعيدة
    عن الإسفاف والشتائم والقذف والجدل الغير موضوعي
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>.






  3. المواضيع العامة يجب ان تكون ذات اهداف نقاشية و من انتاج العضو و المواضيع

    المنسوخة او المنقولة عديمة الفائدة سوف يتم حذفها مباشرة

    .






  4. مختبرات العرب يتجه نحو الإغراض العلمية فقط في المختبر الطبي , و على هذا تمنع

    النقاشات في

    :

    أ- الأمور السياسية و النقد الجارح في الحكام
    .

    ب- النقاشات
    الدينية و الطائفية المتعصبة لعدم وجود أهل الاختصاص
    .

    ج- النقد الجارح و السب و
    التشهير غير الأخلاقي بأعضاء هيئة التدريس في الجامعات
    .

    د- كل ما يعارض سياسة و
    توجه الموقع العلمية و يثير حفيظة الآخرين
    .



  5. style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>عدم
    تكرار
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> المواضيع أو طرحها في أكثر من
    قسم من منتديات مختبرات العرب , ويجب على العضو
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>القيام
    بعملية (البحث) للتأكد من أن الموضوع لم يتم إدراجه من قبل خاصة إذا كان
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>الموضوع منقول وفي حال حدوث ذلك سيتم نقل الموضوع لقسم المواضيع
    المحظورة دون العودة للكاتب style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> .

  6. على العضو التأكد من نوعية
    المشاركة فلكل منتدى
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>مواضيعه
    الخاصة به، وغير ذلك سيتم نقلها إلى مكانها الصحيح دون الرجوع إلى كاتب
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>المشاركة style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> .

  7. يتوجب على العضو كتابة عنوان
    مناسب لموضوعه و الابتعاد عن العناوين المبهم هاو ما يخالف محتوي الموضوع لكي
    لا يتعرض الموضوع للإغلاق أو الحذف.

  8. يتوجب على العضو الاهتمام
    بمتابعة الردود على موضوعه أول
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>بأول
    وعدم تجاهلها
    . lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>خاصة وإذا كانت من النوع الذي ينتظر إجابة من الأعضاء أو نقاش .

  9. يجب أن يكون الحوار في المواضيع
    جادا وهدف المحاورة
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>هو
    الإضافة والاستفادة .
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>


  10. من خلال النقد أو التعقيب على
    المواضيع يراعى
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>عدم
    الإساءة لصاحب الموضوع أو المتحاورين فيه ولكن يجب أن يكون النقد و التعقيب على
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>مضمون الموضوع او ما صاحبه من ردود مع الالتزام بأدب الحوار .

  11. لا يحق lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>للعضو طلب حذف مشاركته بعد التعقيب عليها من الأعضاء كما لا يحق له
    حذف موضوع له يحتوي على ردود .

  12. تمنع مختبرات العرب منع نهائي
    التسجيل بالمنتدى لغرض طلبات البحوث .

  13. منع الإعلانات بأي شكل من
    الأشكال , سواء المواقع أو المنتديات أو شركات أو
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    مستشفيات أو المراكز أو غيرها مالم توافق علية الإدارة
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    . style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#990000'>




ثانيا : موجبات تحرير المشاركة :





  1. الكلمات المؤذية أو style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    الغير لائقة والتي وردت عن غير
    قصد يتم حذفها
    .





  2. التلميحات التي قد تمس أحد style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    الأعضاء بشكل غير مباشر.




  3. المشاركات التي تحوي إساءات
    لثقافات الآخرين
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    وتوجهاتهم
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>إذ أن مبدأ مختبرات العرب هو احترام الرأي الآخر ووجهة نظرة .




  4. عبارات النقد الخاطئ والتي توجه
    لذات الأعضاء والتعرض لهم
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    بالتجريح
    .




  5. الجمل الاستفزازية والتهكمية
    والتي قد تثير حفيظة الآخرين
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    .







  • وهذا يتم بتقدير مشرف القسم أو المشرف العام بحسب ما تقتضيه الحاجة

    وقد يصل الأمر إلى حذف المشاركة
    متى ما كان
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>جلها
    يحوي أي مما سبق .





  • كما أن المشرف ليس ملزماً lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:red'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:red'>بتقديم أي
    تبريرات للعضو عند القيام بتحرير مشاركته أو حذفها أو نقلها للمكان

    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:red'>المناسب لها، ولا يحق للعضو الاعتراض بشكل علني، بل عليه مراسلة المشرف
    على القسم style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:red'>
    أو المشرف العام عن طريق نظام
    الرسائل الخاصة للاستيضاح منه عن مسوغات الإجراء ، أو اللجوء لإدارة الموقع

    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:red'>بمراسلتها عبر البريد الرسمي ولن تقبل أي اعتراضات خارج تلك
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:red'>القناة style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:red'>.





ثالثاً - موجبات حذف مشاركة العضو lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
' class="style3">
style='font-size:14.0pt;font-family:"Tahoma","sans-serif";' class="style3">
والإنذار
:




  1. المشاركات التي تتعرض لأي شخص
    بالإهانة أو الإيذاء أو
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>التشهير
    أو كتابة ما يتعارض مع القوانين المتعارف عليها رسمياً
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    .





  2. المشاركات المسيئة بمجملها
    للآداب العامة وعرض الصور المثيرة للغرائز بطريقة غير
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>مباشرة سواء في التوقيع أو في الصورة الشخصية وسيتم تعديلها وحذفها
    دون الرجوع للعضو style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> .




  3. المشاركات التي تتضمن غزلاً
    مباشراً بأحد الأعضاء
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    .




  4. عدم وضع تواقيع تحتوي كلمات أو
    أشعار غزلية أو صور نساء بأي شكل كان
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:red'>لمنافاتها dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:red'> للأدب والأخلاق والعادات الإسلامية
    القويمة
     .




  5. المشاركات التي تشتمل إساءة
    للأدب والأخلاق
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>العامة .




  6. الوصلات التي توصل بشكل غير
    مباشر إلى مواقع غير مقبولة شرعاً
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>أو
    عرفاً أو وضع بروكسيات لمواقع مشفرة
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    .




  7. الإعلان في صفحات المنتدى أو style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> في توقيع العضو عن مواقع أو
    منتديات أخرى سواء كان بوضع رابط أو كتابة ذلك
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>علناً
    كما يمنع منعا باتا التقدم بإعلان لطلب احد الأعضاء للإشراف على مواقع أخرى
    .




  8. كتابة مشاركات تتضمن اعتراضات
    على الإجراءات الإدارية ، فلا يمكن
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>قبول أي اعتراضات تتخطى بريد الرسائل الخاص بالموقع . وستحذف حال
    كتابتها .




  9. الصوتيات التي تتضمن موسيقى أو
    غزلا أو كلاما مخلا بالآداب
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'> lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>.




  10. عدم طرح أي شكوى ضد مشرف أو عضو
    علناً، ولتقديم شكوى أو ملاحظة يجب
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>مراسلة إدارة المنتديات على العنوان الرسمي .




  11. عدم كتابة مواضيع تختص style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> بالوداع أو ترك المنتدى
    (المواضيع الشخصية) وعلى من يرغب في ذلك مخاطبة الإدارة وإبداء الأسباب
    .




  12. طرح مواضيع للإعلان عن شركات
    ومستشفيات ومراكز تدريب طبية دون العودة للإدارة .





رابعا - موجبات طرد العضو dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";' class="style3">
:





  1. عدم الالتزام بتعاليم الدين
    الإسلامي وعدم كتابة أي موضوع فيه

    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>مساس للمقدسات الإسلامية أو القران الكريم، أو فيما يختص بالأمور
    الفقهية style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    والعقائدية dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>


    أو التعرض للرب عز وجل أو للرسول صلى الله عليه وسلم أو للصحابة
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>رضوان الله عليهم بالسب والشتم lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>أو
    الانتقاص
    .





  2. التعرض لأحد الأعضاء
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> dir=LTR>
    بالسب أو الشتم والتعدي على
    الأعراض بالإساءة
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> dir=LTR> .





  3. ورود شكاوى عن مضايقة style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    الأعضاء أو المعاكسة برسائل
    بريدية عن طريق بريد الموقع أو الرسائل
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>الخاصة.





  4. التسجيل بأسماء غير لائقة أو
    محرمة أو بأسماء شخصيات ذات عداء
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>للإسلام
    والمسلمين
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> أو
    بأسماء شخصيات إدارية معروفة و التحدث بأسمائهم بهدف التضليل .





  5. التعدي على أحد المشرفين أو
    الإداريين بالسب والإساءة
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    .





  6. إرفاق ملفات تحتوي على فيروسات
    عن طريق الموقع بقصد بها الإضرار
    dir=LTR>
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>بالآخرين
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> dir=LTR> .





  7. تكرار ارتكاب المخالفات لثلاث
    مرات يتوجب عندها طرد العضو
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>.





خامسا- العضو والاسم المستعار dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";' class="style3">
:





  1. يجـب اختيار style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    الاسم المسـتعار بعناية ودقة مع
    مراعاة الشروط اللازمة , وسـيعتبر أسمك المسـتعار هـو بمثابة هـوية دخـولك

    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>إلى المنتدى style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> .


    الشروط العامة style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'> :


    أ- يجب أن يكون اسم العضو واضحا وذا دلالة
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>مفهومة style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>.


    ب - يشترط بأن لا يزيد اسم المستخدم عن مقطعين كحد أعلى .





  2. مسئوليتك المحافظة على معلوماتك
    الشخصية للدخول من كلمة سر أو غيرها
    .





سادسا - الجانب التقني dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";' class="style3">
:





  1. يجب
    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>على الأعضاء الالتزام بحجم التوقيع واختيار توقيع مناسبا ويكون صغير
    بالنسبة للحجم style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    والقياس كما يجب التقيد بالتالي :


    أ - لا يجوز وضع اكثر من صورة في خانة lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>التوقيع.


    ب - مقاس التوقيع هو ( 400*200 dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    )


    ج - عدم وضع روابط صوتيه في lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>
    التوقيع.





  2. عدم وضع صور بالتوقيع من
    الفنانين والفنانات وأي صورة تخالف
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>عاداتنا
    وتقاليدنا أو مخالفه لشرع و منها صور النساء  بأي طريقة كانت
    .





  3. اختيار صورة مناسبة تحت اسم
    العضو
    dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>

    بشرط أن لا تكون مما سبق التحذير
    منه
    .





  4. حذف الرسائل الخاصة بعد الانتهاء
    من
    lang=AR-SA dir=LTR style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>
    style='font-size:14.0pt;font-family:"Tahoma","sans-serif";color:#333333'>قراءتها
    وعدم تركها لفترة طويلة لأنها تسبب ضغط على السير فر وتحجز مساحة كبيرة من

    lang=AR-SA style='font-size:14.0pt;font-family:"Tahoma","sans-serif";
    color:#333333'>مساحة الموقع تبطئ التصفح .









شاهد أكثر
شاهد أقل

بحث معدل قياسات السمنة ومسح الطفرات الجينية للدكتور خالد الحربي

تقليص
X
 
  • تصفية - فلترة
  • الوقت
  • عرض
إلغاء تحديد الكل
مشاركات جديدة

  • بحث معدل قياسات السمنة ومسح الطفرات الجينية للدكتور خالد الحربي

    السلام عليكم و رحمة الله و بركاته


    و ددت نقل هذا الموضوع من مجلة نبضنا الصادر عن ملتقى طلاب جامعة الملك سعود في لقائها الحصري مع الدكتور خالد الحربي ......



    [align=center]


    رئيس قسم المختبرات الإكلينيكية يعد لبحث معدل قياسات السمنة ومسح الطفرات الجينية
    معدل قياسات السمنة ومسح الطفرات الجينية في مستقبل الميلانوكيراتين الرابع
    في طلاب جامعة الملك سعود.

    في لقاء حصري بـ ٍ[ نبضنا ] صرح الدكتور خالد الحربي رئيس قسم علوم المختبرات الاكلينيكة
    وأستاذ علم الجينات بكلية العلوم الطبية التطبيقية بجامعة الملك سعود عن بحثه الحالي والذي
    يتضمن بشكل خاص مرحلة أولية تتم على عينة طلاب كلية العلوم الطبية كما تضم مرحلة ثانية عامة
    تضم عينات من مختلف مناطق المملكة وعلى شريحة واسعة من المجتمع السعودي , وتبرز أهمية
    الدراسة في استخلاص المسبب الرئيس للسمنة وزيادة الوزن الممرض عند 5 % من المجتمع والتي
    تعود إلى اكتسابهم لجين محدد ( Mc4r ) وبغض النظر عن المسببات الأخرى التي قد يعزو البعض
    من العامة سببها إلى عدة مسببات وهمية ( اضطراب هرموني , إفراط تناول السكريات , ومن هذا
    القبيل الذي يدفع الكثير للاستعاضة بأعشاب مجهولة المصدر وأدوية وحميات على قدر كبير من
    الـلا مهنية والعشوائية ! )و هذه الدراسة سوف تبحث بشكل مفصل مدى تأثير وارتباط هذا الجين بالسمنة , وفيما يلي نص من مقال كتب بيد الدكتور خالد الحربي يبين فيه أهمية البحث :

    قال صلى الله عليه وسلم (( ما ملأ آدمي وعاءا شرا من بطنه بحسب ابن آدم لقيمات يقمن صلبه فإن
    كان لا بد فاعلا فثلث لطعامه وثلث لشرابه وثلث لنفسه )) رواه الإمام أحمد والترمذي وغيرهما وقوله (المعدة بيت الداء) . قد توصل العلم إلى أن السمنة من الناحية الصحية تعتبر خللا في التمثيل الغذائي وذلك يرجع إلى تراكم الشحوم أو اضطراب الغدد الصماء .. كما أن للوراثة دور كبير في السمنة كما أثبت
    العلم الحديث , وقد أكدت البحوث العلمية أن للسمنة عواقب وخيمة على جسم الإنسان ,
    متمثلا ذلك في العديد من الأمراض مثل مرض البول السكري الذي يصيب الشخص البدين غالبا أكثر من العادي كما أن السمنة تؤثر في أجهزة الجسم وبالذات القلب حيث تحل الدهون محل بعض خلايا عضلة القلب مما يؤثر بصورة مباشرة على وظيفته , ولا يمكن القول بمجرد النظر أن الشخص سمين ويره نحيف والآخر وزنه مثالي الا بمعرفه مؤشر كتلة الجسم ( مؤشر الوزن المثالي) . وقد تم تصنيف مؤشر كتلة الجسم من قبل منظمة الصحة العالمية على النحو الآتي :

    1 – مؤشر النحافة تحت 18,5
    2 – مؤشر الوزن المثالي 18,5 – 42,9
    3 – السمنة 30 فما فوق

    علما بأن مؤشر كتلة الجسم يرتبط بدهون الجسم وهذه العلاقة تختلف باختلاف السن والنوع ومثال
    على ذلك فإن السيدات توجد بأجسامهن نسبة دهون أعلى من الرجال لنفس المؤشر , ونفس الشئ
    لكبار السن مقارنة بصغار السن لنفس المؤشر . انتهى

    ومما يجدر الذكر أن البحث تم بإشراف الدكتور خالد الحربي وبمساعده أساتذة ومعيدين من قسم علوم
    المختبرات الإكلينيكية كما تضمن عدة خطوات لاستيفاء شروط اكتمال العينة ومنها , سحب عينيتين دم , قياس الوزن و الطول والخصر , قياس نسب السوائل والدهون والكتلة العضلية وتركزها في الجسم عبر جهاز مخصص لهذا الغرض .

    [p5s][/p5s]

    و من باب الشئ بالشئ يذكر و ددت اضافة بعض المعلومات عن هذا الجين :

    مسميات هذا الجين :

    Symbol MC4R


    HGNC name melanocortin 4 receptor


    و هو موجود على الكرموسوم Location 18q21.32

    صوره توضيحية للجين على الكرموسوم :



    و هو يحتوي على exon 1 فقط

    [p5s][/p5s]

    و للمزيد من المعلومات عنه اضغط على هذا الرابط

    http://www.dsi.univ-paris5.fr/genatlas/fiche.php?n=946

    http://www.ensembl.org/Homo_sapiens/...166603;db=core


    http://www.ncbi.nlm.nih.gov/entrez/q...ds=4160#refseq


    http://www.ncbi.nlm.nih.gov/entrez/q...&term=14633862

    [p5s][/p5s]


    و هذا هو تريب القواعد النيتروجينيهالموجود على الــ exon في الجين MC4P

    علما ان القواعد اللتي باللون الأزرق هي الانترون و اللتي بالأحرف الكبيره هي الإكسون ..

    EXON 1 يحتوي 999 bp[/align]


    [align=left]ctaaaagagactaaaaactccatgtcaagctctggacttgtgacatttac tcacagcagg
    catggcaattttagcctcacaactttcagacagataaagacttggaggaa ataactgaga
    cgactccctgacccaggaggttaaatcaattcagggggacactggaattc tcctgccagc

    ATGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGCACCTCTGGAA CCGCAGCAGT
    TACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGA TGGAGGGTGC
    TACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCAT CAGCTTGTTG
    GAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTC ACCCATGTAC
    TTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAA TGGATCAGAA
    ACCATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTT CACAGTGAAT
    ATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCAT TTGCAGCCTG
    CTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTA CCATAACATT
    ATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTG CACGGTTTCA
    GGCATTTTGTTCATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCT CATCACCATG
    TTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCT GATGGCCAGG
    CTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCA AGGTGCCAAT
    ATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTG CTGGGCCCCA
    TTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCAGAATCCATATTG TGTGTGCTTC
    ATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCAT CGATCCTCTG
    ATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGATCAT CTGTTGCTAT
    CCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAA
    atggggacagagcacgcaatataggaacatgcataagagactttttcact cttaccctac
    ctgaatattgtacttctgcaacagctttctcttccgtgtagggtactggt tgagaatatc
    cattgtgtaaatttaagcctatgatttttaatgagaaaaaatgcccagtc tctgtattat
    [/align]

    [p5s][/p5s]

    مقال علمي منشور عن هذا الجين صادر من جامعة كالفورنيا سان فرانسسكو ....


    [align=left]The human MC4R promoter: characterization and role in obesity.

    Lubrano-Berthelier C, Cavazos M, Le Stunff C, Haas K, Shapiro A, Zhang S, Bougneres P, Vaisse C.
    Department of Medicine, University of California San Francisco, San Francisco, California 94143-0573, USA.

    Heterozygous mutations in the coding sequence of the serpentine melanocortin 4 receptor (MC4R) are the most frequent genetic cause of severe human obesity. Since haploinsufficiency has been proposed as a causal mechanism of obesity associated with these mutations, reduction in gene transcription caused by mutations in the transcriptionally essential regions of the MC4R promoter may also be a cause of severe obesity in humans. To test this hypothesis we defined the minimal promoter region of the human MC4R and evaluated the extent of genetic variation in this region compared with the coding region in two cohorts of severely obese subjects. 5'RACE followed by functional promoter analysis in multiple cell lines indicates that an 80-bp region is essential for the transcriptional activity of the MC4R promoter. Systematic screening of 431 obese children and adults for mutations in the coding sequence and the minimal core promoter of MC4R reveals that genetic variation in the transcriptionally essential region of the MC4R promoter is not a significant cause of severe obesity in humans.

    PMID: 14633862 [PubMed - indexed for MEDLINE][/align]

    [p5s][/p5s]

    بالتوفيق دكتور خالد

    [p5s][/p5s]
    التعديل الأخير تم بواسطة الواقع والحياد; الساعة 03-06-2007, 11:30 AM.

  • #2
    الله يعطيك ألف عافية



    وبالتوفيق للدكتور في هذا البحث

    تعليق


    • #3
      يعطيك العافية الواقع على نقل موضوعي وان شاء الله قدرنا نوصل للي كنا نبيه

      حبيت اضيف فقط رابط المجلة :

      http://www.cksu.com/ob/

      وهنا الرابط الأصلي للمقال :

      http://www.cksu.com/ob/index.php?mag=harbi

      بالتوفيق لك اختي الواقع والله يوفق الجميع لما يطمحون له
      كما سأضيف موضوع يحوي الملف الرئيسي والمعتمد والمؤلف بواسطة الدكتور خالد الحربي
      حصريا على مختبرات العرب

      كما اشكر الزميل دكتور اكس على تصاميمة الجميلة ومساعدتنا انا وارابس لاب
      بالتقاط الصور
      التعديل الأخير تم بواسطة رائد فرزان; الساعة 04-06-2007, 10:40 PM.

      تعليق


      • #4
        بارك الله فيك

        تعليق


        • #5
          شكراً لمنتدى مختبرات العرب وللواقع والحياد على التفاعل مع الموضوع من البداية للنهاية

          وإن شاء الله حقق مايراد التوصل إليه من هذه الدراسة العلمية الفريدة

          تعليق


          • #6
            ماشاء الله علية

            ربي يعطيك الف عافية اختي على النقل الحلو

            تعليق


            • #7
              موفقة ان شاء الله

              تعليق


              • #8
                شكرا لك على هذا الموضوع الخميل

                تعليق


                • #9
                  شكرا على الموضوع
                  ولكن كيف نحصل على تسلسل النيكليوتيدات لجين معين محدده عليه مناطق الهكون والانترون

                  تعليق

                  يعمل...
                  X