صفحة 1 من 15 12311 ... الأخيرةالأخيرة
النتائج 1 إلى 10 من 149

الموضوع: تقنية P C R للتحاليل الطبية

  1. #1
    تاريخ التسجيل
    Jun 2008
    الدولة
    ليبيا
    المشاركات
    1,355

    Lightbulb لاول مرة تقنية P C R للتحاليل الطبية (vedio )

    السلام عليكم ورحمة الله وبركاته
    اقدم اليكم هذا الملف عسى الله ان ينفعنا واياكم





    مع خالـــــــــــــــــــــــــــــــص تحياتي
    السنوسي احموده احمد
    اخصائي تحاليل طبيه


    المقدمة
    تحفظ المعلومات الوراثية و انتاج المواد لصنع الخلايا و الحفاظ عليها في داخل الحمض النووي (DNA ) . و تقوم الخلية بمضاعفة كمية الحمض النووي وقت انقسام الخلية بشكل تلقائي و بشكل سريع مع وجود نظام تصحيح للأخطاء خلال النسخ. . و تبلغ سرعة النسخ والمضاعفة إلى 1000 قاعدة نيتروجينية بالثانية ( داخل النظام الحيوي ) و هي كما ذكرنا تحدث في الخلية في وقت التكاثر والانقسام فقط .
    ومع التطور في مجال التكنولوجيا الحيوية والذي يقوم على التعامل مع الحمض النووي (DNA ) بشكل أساسي ، استدعى ذلك العلماء على أن يبحثوا عن طريقة أو تقنية تقوم على مضاعفة كمية الحمض النووي (DNA ) بشكل كبير ، فكان هناك عدة محاولات لتنشيط الخلية على الانقسام المستمر بإضافة عوامل النمو growth factors ، ولكن هذه الطريقة لم تكن ذات جده لدى العلماء لأسباب كثيرة. إلى أن توصل العالم د. كري مولس Dr. Kerry Mullis في عام 1985 ( و قد حصل على جائزة نوبل في الكيمياء عام 1993)بنشر اختراعه لتقنية البي سي ار PCR فكانت هذه التقنية بوابة لكثير من التطورات المتسارعة في مجال التكنولوجيا الحيوية ، من أهم الأسباب التي ساعدت هذه التقنية على الانتشار عدم اعتمادها على النظام الحيوي(أي الخلية) و التحكم بكمية الحمض النووي (DNA ) و وسرعة في الإنتاج ولكن كان من عيوب هذه التقنية عدم وجود نظام إصلاح أخطاء الارتباط الخاطئ miss match .
    ما هو PCR :
    هو تقنية مخبريه تم اكتشافها عام 1983م تقريباً تقوم على إكثار نسخ الحمض النووي (DNA ) خارج النظام الحيوي . أي أنها طريقة لنسخ الحمض النووي في المختبر. و لذلك فهي تقنية حيوية لاستنساخ قطعة من محددة من الحمض النووي و مضاعفة إنتاجها لكي يتسنى إجرى عليه اختبارات و فحوصات إضافية. تفاعل البوليمراز السلسليPolymerase Chain Reaction (PCR)
    تهدف تقنية PCR إلى تضخيم جزيئات قليلة من الحمض النووي DNA، بعد استخلاصه من خلايا أو سوائل الجسم وبالتالي الحصول على كميات كبيرة منه يمكن إجراء التحليل عليه. يمكن اعتبار تقنية PCR ترجمة مبسطة لعملية انتساخ الحمض النووي DNA أثناء الانقسام الخلوي.ولكي يتم هذا الانتساخ، لا بد من توفر مواد معينة تساعد على ذلك:
    .1 البادئات Primers وهي عبارة عن نيوكلوتيدات قليلة Oligonucleotides (18 – 20 أساس آزوتي) قادرة على الارتباط مع الأسس الآزوتية للحمض النووي المراد تضخيمه، وذلك في منطقة ذات ترتيب مميز ونوعي غير متبدل للأسس الازوتية في الحمض النووي أو ما يعرف بمنطقة عالية الحفظ Highly Conserved Region .
    .2 كميات وافرة من النيوكليوزيدات ثلاثية الفوسفات منقوصة الأوكسجين
    (dATP,dCTP,dGTP,dTTP)Deoxynuleoside triphosphates(dNTPs)
    .3 أنظيم البوليميراز Polymerase مقاوم للحرارة المرتفعة، وأهمها Taq Polymerase المستخلص من بكتيريا تعيش في الينابيع الحارةThermus aquaticus.
    .4 محاليل واقيه Buffers
    .5 شوا رد مناسبة، أهمها شاردة المغنيزيوم Mg+2 التي تعتبر عامل متمم Cofactor لأنظيم البوليمراز.

    تتألف تقنية PCR من ثلاث مراحل في دورة واحدة:
    • مرحلة التمسخ الحراري Thermal denaturation لجزيءDNA الهدف، أي فصل الطاق المزدوج ds-DNA إلى طاقين منفصلين ss-DNA. وتتم هذه المرحلة عند درجة حرارة 94 م .
    • مرحلة تشفع البادئات Primers annealing، أي ارتباط كلا البادئتين مع الطاقين المنفصلين عند درجة حرارة 55م
    • تطاول البادئات المتشفعة Annealed primers extension بمساعدة أنظم البوليمراز وذلك بإضافة dNTPs ابتداء من البادئة وفي الاتجاه 3← 5، وتتم هذه المرحلة عند درجة حرارة 72 م.
    تعاد هذه الدورة ذات الخطوات الثلاثة عدداً من المرات، مما يؤدي إلى زيادة جزيئات DNA بشكل أسي.
    ويعطى عامل التضخيم بالمعادلة التالية = n ( 1+E )x ، حيثn = الكمية البدئية للحمض النووي الهدف
    E = فعالية التضخيم ( (Efficiency
    X = عدد دورات PCR
    يمكن تطبيق تقنية PCR على الحمض النوويRNA بإجراء خطوه أولية وهي تكوين نسخة متممة من
    ComplementaryDNA(cDNA)DNA
    بواسطه انظيم الترنسكريتباز العكوسreverse transcriptase، ليخضعcDNA بعدها لمراحل التتضخيم السابقة.
    وتعرف هذه التقنيةRT-PCR
    يمكن الكشف عن منتجات التضخيم Amplicons بعدة طرق أهمها:
    .1 الرحلان الكهربائي على هلامة الآغاروز Agarose Gel Electrophorsis .
    .2 التهجين Hybridizationباستعمال مسابر موسومة بأنظيم Enzyme Labeled Probes
    .3 استخدام بادئات موسومة بأنظيم أو مادة تألقية Enzyme Fluoresent Labeled Primers
    .4 تقنية تعدد اشكال اطوال الشدف الحصريه
    (RFLP) Restriction Fragment Length Polymorphism
    .5 التنسيل Cloning
    إن الحساسية العالية التي تبديها تقنية PCR، تجعلها عرضة لإعطاء نتائج إيجابية كاذبة بسبب تلوث خارجي المنشأ Contamination Exogenous. أهم مصادر هذا التلوث :
    .1 التلوث بمنتجات تضخيم سابقة Carryover contamination
    .2 التلوث من عينة أخرى Sample to sample contamination
    لذا يعتبر التلوث العقبة الوحيدة المهمة التي تواجه استخدام تقنية PCR لغايات تشخيصية. يمكن تجنب التلوث بالانتباه لتفاصيل العمل المخبري بتقنيةPCR .لذلك تم الاعتماد على تقسيم مكان العمل إلى ثلاثة أقسام منفصلة عن بعضها بشكل تام:
    .1 قسم الاستنهاض Extraction sector
    .2 قسم تحضير الكواشفReagent preparation sector
    ) وهذان القسمان يعرفان بــــPre – PCR sector)
    .3 قسم التضخيم والمعايرة Amplification + Detection sector
    (ويعرف هذا القسم بــــ Post- PCR Sector )
    هناك عدة تطبيقات لتقنية PCR : تداخلي Nested
    لا تماثلي Asymmetric
    تمايزي Differential
    لكن أهمها تطبيقان:
    .1 PCR التنافسي (Competitive PCR)، ويشكل المبدأ الرئيسي للمقايسة الكمية باستخدام مرصاف خارجي المنشأ Exogenous template كعياري داخلي. حيث يتنافس هذا العياري الداخلي Internal Standard و الحمض النووي الهدف على البادئات ذاتها اثناء عملية التضخيم، ثم تجرى المقايسة الكمية للناتجين باستخدام طرق مختلفة.
    .2 PCR سريع الدورة ذي الوقت الواقعي Rapid Cycle Real- Time PCR، حيث امكن اجراء عملية التضخيم بدورة حرارية مدتها 20 – 60 ثانية، كماامكن تحليل منتجات عملية التضخيم أثناء عملية التضخيم باستخدام صبغات تألقية.
    التطبيقات السريرية لتقنية PCR :
    .1 الكشف المباشر للعامل الخمجي الممرض (جرثومي – فيروسي – طفيلي... ) قبل ارتكاس الجهاز المناعي لهذا العامل (إنتاج الأضداد). في الماضي، يتم الكشف عن العامل الممرض بشكل غير مباشر عن طريق كشف/ معايرة الأضداد:
    - إيجابية كاذبة ← أضداد غير نوعية
    - سلبية كاذبة ← تأخر ظهور / إنتاج الأضداد لأسباب مناعية.
    وبشكل مباشر عن طريق الزرع ← صعوبة زرع الفيروسات
    طول فترة الزرع كمال هي الحال في عصيات السل
    .2 تحديد الحمل الفيروسي Viral Load وتحديد إمكانية المعالجة أم لا
    .3 مراقبة وتقييم المعالجة :
    PCR y ← استجابة
    PCR Å ← عدم استجابة ← خطة علاجية جديدة
    PCR y ثم Å في فترة المعالجة ← Break Through ← خطة علاجية جديدة
    PCR y ثم Å بعد انتهاء المعالجة ← نكس
    .4 تحديد الأنماط الجينية Genotyping للفيروس الكبدي C
    .5 الأمراض الوراثية : أ – كشف الأساس الجيني للمرض الوراثي عند الكاهل، ومعرفة الحاملين والمصابين ومن ثم المشورة الوراثية الصحيحة
    ب – الكشف عنها قبل ظهور الأعراض والعلامات
    ج – الكشف عنها عند الجنين أثناء الحمل، أو في حديثي الولادة
    .6 تشخيص الأمراض السرطانية بالكشف الجيني للتوضع الغير طبيعي للأسس الآزوتية للجينات الورميه Oncogenes
    .7 تعيين الأنماط النسيجية HLA- tissuc typing في مجال زراعة الأعضاء
    .8 تلعب تقنية PCR دوراً هاماً في الطب الجنائي والشرعي.
    أخيراً وليس أخرا، كانت تقنية PCR تستخدم في تسعينيات القرن الماضي كاختبارات استقصائية متممة، ولكن في نهاية القرن العشرين بدأت هذه التقنية تحل محل تقنيات كثيرة أخرى لأنها أثبتت فعالية كبيرة ودقة ممتازة.
    وفي مطلع القرن الواحد والعشرين وبعد إتمام سلسلة الجينوم البشري، أصبح ينظر إلى كامل هذا القرن بأنه قرن الجينوميات Genomics وسيكون لتقنيةPCR دوراً أساسياً في هذه الثورة العلمية الكبرى.

    ما هي متطلباتPCR :
    لتقوم بإنتاج الحمض النووي (DNA ) بواسطة PCR يتتطلب عليك توفير :
    1. جهاز للتحكم بدرجات حرارة التفاعل بشمل دقيق و متتالي ( الدورة الحرارية Thermocycle ) : ويقوم هذا الجهاز بتغير درجة الحرارة بشكل سريع ، لآن تغير درجة الحرارة هو الأساس الذي تقوم عليه فكرة هذه التقنية .
    2. البليمريز : وهو الإنزيم الذي يقوم ببناء وترتيب القواعد النيتروجينية ( حدات الحمض النووي (DNA ) ) ، ويجب أن يكون هذا الإنزيم مقاوم للحرارة العالية ليتمكن من العمل . و قد اكتشف انزيم مقاوم للحرارة و اسم تاج Tag
    3. مجموعة متفرقة من القواعد النيتروجينية: ( A T C G ) ليتمكن الإنزيم من ترتيبها في مواقعها أثناء عملية نسخ الحمض النووي (DNA ) .
    4. بريمر Primer : وهو قطعة صغيرة من الحمض النووي (DNA ) ليتمكن الإنزيم من بداء البناء و النسخ عليها .
    5. والشيء الأهم هو وجود نسخة من الحمض النووي (DNA ) المراد نسخه .
    6. بالإضافة إلى محلول أو وسط ليتم به التفاعل : وهذا المحلول يختلف بين تفاعل و أخر .
    عملية النسخ :
    بعد وضع الحمض النووي المراد نسخة مع البريمر و و إنزيم البوليمريز و مجموعة مع الأحماض النووية في أنبوب داخل جهاز التحكم الحراري فان هناك 3 مراحل منفصلة تمر بها عملية النسخ:
    1. مرحلة التفكيك Denature : رفع الحرارة إلى 94 ْم وذلك لفك الحمض النووي (DNA ) الأصل .
    2. مرحلة الالتصاق anneal : إنزال الحرارة إلى ما بين 55-60 ْم ليقوم البريمر بالألتزاق فيزيائياً بواسطة الروابط الهيدروجينية مع الحمض النووي (DNA ) الأصل .
    3. مرحلة الامتداد extend : ثم يقوم برفع درجة الحرارة إلى 75 ْم ليقوم البلمريز بعمله في بناء الحمض النووي (DNA ) الجديد .
    وهذه المراحل الثلاث تعتبر دورة كاملة وفيها يصبح الحمض النووي (DNA ) الأصل قد تضاعف ، وتعتمد كمية ناتج الحمض النووي (DNA ) على عدد الدورات ( والصورة التالية توضح العملية ) .
    لمشاهدة هذه العملية اضغط على هنا.
    تطبيقات PCR :
    لتقنية PCR تطبيقات كثيرة في مجال أبحاث الحمض النووي (DNA ) و الوراثة ومنها :
    1. الكشف عن الطفرات الوراثية : وذلك عن طريق وضع بريمر خاص للطفرة لتكثير الجين الخاص بها . ومنه نقوم بمعرفة المرض إذا كان على زوجين الكروموسومات أو على احدهما ( allele ) .
    2. تعين البصمة الوراثية .
    3. الكشف عن الفيروسات : وهذه الطريق هي الأدق في تحديد نوع وجنس الفيروس وكميته.
    4. هو العنصر الأهم في عملية التجميع الجيني ( Recombinant الحمض النووي (DNA ) ) : حيث نقوم بتكثير الجين المراد إدخاله على البلازمد أو الحمض النووي (DNA ) المضيف .
    5. استخدامه في تغير نهايات الجين لتصبح متوافقة مع إنزيمات القطع ( Restriction enzyme ) .
    6. هو العملية الأساس في تحديد تتابع القواعد النيتروجينية في الحمض النووي (DNA ) ( الحمض النووي (DNA ) Sequencer ) .
    7. معرفة طول الحمض النووي (DNA ) .
    8. تقنية الحمض النووي (DNA ) المكمل ( cالحمض النووي (DNA ) ) .
    9. تحديد الجين المطلوب من خليط من الجينات .
    10. يستخدم في تقنية (microarrays ).
    11. في مشروع الخارطة الجينية البشرية (human genome project ) .
    12. الساوثرين بلوت (southern plot ) .
    13. تقنية ارتباط الحمض النووي (DNA ) – بروتين ( الحمض النووي (DNA ) -Protein Interaction ) .
    14. في مجال الطب الشرعي ( اختبار الأمومة ، حالات الاغتصاب ، تحديد الهوية ... الخ ) .
    وغيرها من التطبيقات المخبرية والبحثية .
    أنواع PCR : هناك نوعان من PCR :
    1. PCR العادي : وهو ما تم شرحه والتطرق اليه في الخطوات السابقة .
    2. rtPCR : وهو اختصار لـ ( Real Time PCR ) : وهذا النوع يقوم على نفس المبدأ ولكن الخلاف الوحيد يكون مربتط الجهاز بكمبيوتر لتحديد الوقت الحقيقي لبدا التفاعل ومن ثم الكمية الحقيقية لعدد نسخ الحمض النووي (DNA ) ويعتمد ذلك على وجود قواعد نيتروجينية حرة مشعة لتحديد ذلك . مما يسهل على الباحثين الوقت لتحدد وجود الجين المطلوب أو لا ، وكمية الجين بدون الوصول إلى نهاية الدورات الحرارية المحددة .

    What The Heck is PCR? ~~~
    ________________________________________


    Polymerase chain reaction (PCR) is a technique which is used to amplify the number of copies of a specific region of DNA, in order to produce enough DNA to be adequately tested. This technique can be used to identify with a very high-probability, disease-causing viruses and/or bacteria, a deceased person, or a criminal suspect.
    In order to use PCR, one must already know the exact sequences which flank (lie on either side of) both ends of a given region of interest in DNA (may be a gene or any sequence). One need not know the DNA sequence in-between. The building-block sequences (nucleotide sequences) of many of the genes and flanking regions of genes of many different organisms are known. We also know that the DNA of different organisms is different (while some genes may be the same, or very similar among organisms, there will always be genes whose DNA sequences differ among different organisms - otherwise, would be the same organism (e.g., same virus, same bacterium, an identical twin; therefore, by identifying the genes which are different, and therefore unique, one can use this information to identify an organism).
    A gene's building-block sequence is the precise order of appearance, one after the other, of 4 different components (deoxyribonucleotides) within a stretch of DNA (deoxyribonucleic acid). The 4 components are: Adenine, Thymidine, Cytosine and Guanine, abbreviated as: A, T, C and G, respectively (a 4-letter alphabet). The arrangement of the letters (one after the other) of this 4-letter alphabet generates a "sentence" (a gene sequence). The number of letters in the sentence may be relatively few, or relatively many, depending on the gene. If the sentence is 1000 letters-long, the sequence would be said to be 1 kilobase (1000 bases).
    As an example:
    ATATCGGGTTAACCCCGGTATGTACGCTA would represent part of one gene. DNA is double-stranded (except in some viruses), and the two strands pair with one another in a very precise way. EACH letter in a strand will pair with only one kind of letter across from it in the opposing strand: A ALWAYS pairs with T; and, C ALWAYS pairs with G across the two strands.
    So:
    TTAACGGGGCCCTTTAAA........TTTAAACCCGGGTTT

    Would pair with:
    AATTGCCCCGGGAAATTT........AAATTTGGGCCCAAA


    Now, let's say that the above sequences "flank" (are on either end of..) the gene, which includes a long stretch of letters designated as: ..............
    These are known, absolutely identified to be, the sequence of letters which ONLY flank a particular region of a particular organism's DNA, and NO OTHER ORGANISM'S DNA. This region would be a target sequence for PCR.
    The first step for PCR would be to synthesize "primers" of about 20 letters-long, using each of the 4 letters, and a machine which can link the letters together in the order desired - this step is easily done, by adding one letter-at-a-time to the machine (DNA synthesizer). In this example, the primers we wish to make will be exactly the same as the flanking sequences shown above. We make ONE primer exactly like the lower left-hand sequence, and ONE primer exactly like the upper right-hand sequence, to generate:

    TTAACGGGGCCCTTTAAA........TTTAAACCCGGGTTT
    AATTGCCCCGGGAAATTT.......................>
    and:
    <................................................. ....TTTAAACCCGGGTTT
    AATTGCCCCGGGAAATTT........AAATTTGGGCCCAAA

    Now. the ........ may be a very long set of letters in-between; doesn't matter. If you look at this arrangement, you can see that if the lower left-hand primer sequence (italics) paired to the upper strand could be extended to the right in the direction of the arrow, and the upper right-hand sequence paired to the lower strand could be extended to the left in the direction of the arrow (remembering that the ......... also represent letters, and opposite pairing will ALWAYS be A to T and C to G), one could successfully exactly duplicate the original gene's entire sequence. Now there would be four strands, where originally there were only two. If one leaves everything in there, and repeats the procedure, now there will be eight strands, do again - now 16, etc.. therefore, about 20 cycles will theoretically produce approximately one-million copies of the original sequences (2 raised to the 20th power).
    Thus, with this amplification potential, there is enough DNA in one-tenth of one-millionth of a liter (0.1 microliter) of human saliva (contains a small number of shed epithelial cells), to use the PCR system to identify a genetic sequence as having come from a human being! Consequently, only a very tiny amount of an organism's DNA need be available originally. Enough DNA is present in an insect trapped within 80 million year-old amber (fossilized pine resin) to amplify by this technique! Scientists have used primers which represent present-day insect's DNA, to do these amplifications.
    Here is how PCR is performed:
    First step: unknown DNA is heated, which causes the paired strands to separate (single strands now accessible to primers).
    Second step: add large excess of primers relative to the amount of DNA being amplified, and cool the reaction mixture to allow double-strands to form again (because of the large excess of primers, the two strands will always bind to the primers, instead of with each other).
    Third step: to a mixture of all 4 individual letters (deoxyribonucleotides), add an enzyme which can "read" the opposing strand's "sentence" and extend the primer's "sentence" by "hooking" letters together in the order in which they pair across from one another - A:T and C:G. This particular enzyme is called a DNA polymerase (because makes DNA polymers). One such enzyme used in PCR is called Taq polymerase (originally isolated from a bacterium that can live in hot springs - therefore, can withstand the high temperature necessary for DNA-strand separation, and can be left in the reaction). Now, we have the enzyme synthesizing new DNA in opposite directions - BUT ONLY THIS PARTICULAR REGION OF DNA.
    After one cycle, add more primers, add 4-letter mixture, and repeat the cycle. The primers will bind to the "old" sequences as well as to the newly-synthesized sequences. The enzyme will again extend primer sentences ... Finally, there will be PLENTY of DNA - and ALL OF IT will be copies of just this particular region. Therefore, by using different primers which represent flanking regions of different genes of various organisms in SEPARATE experiments, one can determine if in fact, any DNA has been amplified. If it has not, then the primers did not bind to the DNA of the sample, and it is therefore highly unlikely that the DNA of an organism which a given set of primers represents, is present. On the other hand, appearance of DNA by PCR will allow precise identification of the source of the amplified material.


    وقت ممتع مع (PCR SONG ) SONUCI_2010 LYBIA
    [ame]http://www.youtube.com/watch?v=hfZ8o9D1tus[/ame]

    ----------------------
    [ame]http://www.youtube.com/watch?v=xSFeEDiB3bA[/ame]

    ---------------------
    [ame]http://www.youtube.com/watch?v=vbdAmNmjBqY[/ame]

    --------------------
    [ame]http://www.youtube.com/watch?v=v4L7rvmBXbY[/ame]

    -------------------
    [ame]http://www.youtube.com/watch?v=rgj0BifStM8[/ame]
    ------------------
    [ame]http://www.youtube.com/watch?v=aGNYc8Etlc0[/ame]
    ------------------

    [ame="http://www.youtube.com/watch?v=x5yPkxCLads"]http://www.youtube.com/watch?v=x5yPkxCLads[/ame]
    ----------------------------------------------------------------------------

    المفاهيم الابجدية للهندسة الوراثية



    1. ضعفاني Diploid : عدد الصبغيات الموجود في الخلية الجسمية " مجموعتين من الصبغيات " .

    2. فرداني Haploid : عدد الصبغيات الموجود في الخلية الجنسية " مجموعة واحدة من الصبغيات " .

    3. ليغاز ال DNA = DNA ligase : الأنزيم الذي يربط نهايتي DNA مع بعضهما .

    4. بولي ميراز ال DNA = DNA polymerase : الأنزيم الذي يضاعف ال DNA " ينسخ ال DNA " . إن أنزيم ال DNA بليمراز مؤلف من حوالي 1000 حمض أميني وهو فعال عندما يكون على شكل كروي وهو يعمل باتجاه توضع النيوكليوتيدات من ( 5 َ إلى 3 َ ) وهو لايعمل بالاتجاه المعاكس أي لايعمل بالاتجاه من (3 َ إلى 5 َ ) … هناك ثلاثة أنماط من ال DNA بليمراز :

    DNA بليمراز I

    DNA بليمراز II

    DNA بليمراز III

    أما وظيفة كلاً منها :

    DNA بليمراز III المسؤول عن تضاعف ال DNA .

    DNA بليمراز I يقوم بتصليح ال DNA .

    DNA بليمراز II وظيفته غير معروفة ، ويعتقد بأنه يقوم بدلاً عن I ، II عند عطل إحداهما .

    1. النكليوزيد : هو عبارة عن أساس + سكر .

    2. ترتبط النكليوزيدات مع بعضها البعض بزمر فوسفاتية لتعطي البنية الخطية لل D NA .

    3. ال DNA يتألف من مناطق مختلفة تسمى اكسونات وبالعامية تسمى ( دخلون ) و انتيرونات تسمى كذلك ( عبرونات ) .

    4. اكسونات : وهي مشفرة وهي مناطق لها معنى .

    5. انتيرونات : وهي غير مشفرة وهي مناطق ليس لها معنى .

    6. ( 15 – 17 % ) من المورثات لها معنى ، مثلاً :

    عند الإنسان ( 100000 ) مورثة من ال ( 15 – 17 % ) .

    7. عملية التصفير : يقوم أنزيم بقطع الانتيرونات وحذفها والحصول على الاكسونات لذلك يسمى RNA فعال ، لذلك لايحدث تطابق ( تشذيب ) .

    1. قاهرة Dominant : وهو مصطلح يستخدم لوصف سمة معينة ( صفة ) تتظاهر في شخص يكون مختلف الأمشاج ( أو متماثل الأمشاج ) بالنسبة لل جين المسؤول عن هذه السمة .

    2. صاغرة Recessive : مصطلح يستخدم لوصف سمة معينة تتظاهر فقط في الأشخاص متماثلي الأمشاج بالنسبة لل جين المسؤول عن هذه السمة ( ولا تظهر في مختلفي الأمشاج ، الذين يدعون بال حملة ) .

    3. إكسون Exon : هو جزء من ال جين ، يتمثل في المنتج النهائي لل RNA المرسال المشذب ( المعقود ) .

    4. إنترون Intron : جزء من ال جين ، لا يتمثل في ال RNA المرسال النهائي ، لأنه تتم إزالته أثناء تشذيب وعقد قطعتي الإكسون الموجودتين على كلا طرفيه .

    5. التعبيرية Expressivity : هي الدرجة التي يستطيع فيها الجين أن يعبر عن نفسه ظاهرياً " شدة وضوح السمة ظاهرياً " .

    6. الإختراق Penetrance : هو نسبة الأفراد الذين يحملون نمط جيني معين وبنفس الوقت يحملون النمط الظاهري الموافق له .

    7. الإختراق الكامل : يحدث عندما نرى سمة قاهرة تتظاهر بكل الأفراد الذين يحملون واحداً على الأقل من الجينات الموافقة لها ، أو عندما نرى سمة متنحية تتظاهر بكل الأفراد الذين يحملون كلا ال جينين الموافقين لها

    8. الإختراق غير الكامل : يحدث عندما لا يعبر النمط الجيني عن نفسه دائماً بشكل نمط ظاهري موافق " كأن يحمل شخص ما مثلاً الجين المسبب للنوروبلاستوما ( وهي سمة قاهرة ) دون أن يصاب بهذا المرض ، فنقول إن جين النوربلاستوما هو جين ذو اختراق غير كامل .

    9. جميعة الجينات Gene Pool : هي كل المعلومات الجينية " الوراثية " المحتواة في كل الجينات الموجودة في جمهرة عينة متناسلة في وقت معين .

    10.الواسم الجيني Genetic Marker : وهي صفة شكلية خارجية معينة ( عادة تكون سهلة الملاحظة أو الكشف عنها ) يمكن السيطرة عليها جينياً ، تستخدم في الدراسات الوراثية .

    11.المجين Genome : هو الكمية الكاملة للمواد الوراثية الموجودة في الخلية .

    12.النمط الجيني Genotype : وهو البنية الجينية ، أو المحتوى الجيني للفرد .

    13.النمط الظاهري Phenotype : هو شكل ، أو مظهر الفرد . وهو مجموعة السمات التي يحملها الفرد ، سواء أكانت هذه السمات محسوسة كلون العينين مثلاً أو كانت داخلية غير مدركة بالحواس العادية كنوع زمرة الدم مثلاً . والنمط الظاهري عادة ينتج من التأثير المتبادل بين النمط الجيني للفرد والبيئة المحيطة به .

    14.متغاير الأمشاج Heterozygote : فرد يملك أليلتين " Allele " مختلفتين في الموضعين المتوافقين لزوج من الصبغيات .

    15.متماثل الأمشاج Homozygote : فرد يملك أليلتين متماثلتين في الموضعين المتوافقين لزوج من الصبغيات .

    16.النمط النووي Karyotype : عدد ، حجم ، وشكل الصبغيات في الخلية .

    17.وحيد الصبغي Monosomy : حالة يكون فيها أحد صبغيات زوج صبغي معين مفقوداً " كأن نقول مثلاً : وحيد الصبغي " 23 " وهي حالة يكون فيها الصبغي 23 مفرداً والخلية تحمل 45 صبغياً ( زوج من كل نوع ما عدا الصبغي 23 ) " .

    18.التثلث الصبغي Trisomy : وجود ثلاثة صبغيات من نفس الشكل في الخلية بدلاً من إثنين ، مما يعطي عدد إجمالي للصبغيات يبلغ " 47 " .

    19.اختلال الصيغة الصبغية Aneuploidy : هي أية صيغة صبغية ليست من المضاعفات الصحيحة للصيغة الصبغية الفردية " Haploid " والموجودة عادة في الخلايا الجنسية " وتدعى مجموعة Set " . " وهي تبلغ بالإنسان 23 صبغي " .

    20.صبغي جسدي Autosome : أي صبغي غير الصبغيات الجنسية أو الصبغيات المتقدرية . ( هناك 22 زوج من الصبغيات الجسدية في الإنسان ) .

    21.طرفي المركز Acrocentric : مصطلح يستخدم لوصف الصبغيات ، التي يكون القسيم المركزي فيها ( Centromere ) قريباً من إحدى نهايتي الصبغي بحيث يمنحه ذراع طويل وذراع قصير .

    22.القسيم المركزي Centromere : هي النقطة التي يلتقي بها الشقان الصبغيان (( Chromatid )) للصبغي الواحد ، وأيضاً هي النقطة التي ترتبط بها ألياف المغزل بالصبغيات خلال الانقسام المنصف ( Meiosis ) والانقسام الفتيلي ( Mitosis ) .

    23.مركزي المركز Metacentric : مصطلح يوصف به الصبغي الذي يكون فيه القسيم المركزي قريباً من الوسط .

    24.الشق الصبغي (( Chromatid )) هو واحد من الخيطين الصبغيين ، اللذان يتصلان ببعضهما بالقسيم المركزي ويشكلان مع بعضهما الصبغي كما يرى خلال عملية الإنقسام .

    25.الموضع Locus : هو مكان ال جين على الصبغي .

    26.موزاييكي Mosaics : مريض يحمل في بنيته نمطين مختلفي الصيغة الصبغية من الخلايا .

    27.الارتباط الجنسي Sex Linkage : حمل ال جينات على الصبغيات الجنسية .

    28.أليل Allele : هو الشكل البديل أو المغاير لمورثة ما ( ل جين ما ) يحتل نفس الموضع ( Locus ) على الصبغي الآخر لزوج معين من الصبغيات .

    29.جين " مورثة " Gene : جزء من ال DNA ، مسؤول عن انتاج سلسلة معينة من عديد الببتيد " Polypeptide " . ويتألف عادة من عدد مختلف من النوكليوتيدات " Nucleotides " .

    30.نوكليوتيد Nucleotide : وهو الوحدة الأساسية للحموض النووية ( DNA و RNA ) ، يتألف من أساس آزوتي " بورين أو بيريميدين " + جزيء سكر خماسي " بنتوز " + مجموعة فوسفات .

    31.عاثية الجراثيم Bacteriophage : هي فيروس جرثومي ، يبتلع إلى داخل الجرثوم ، ويتم تعديله ، ويستخدم كناقل " Vector " أو حامل لتناسل ال DNA الجرثومي .

    32.السمة Trait ، Character : هي صفة شكلية خارجية يمكن ملاحظتها أو التحري عنها ، في الكائن الحي .

    33.الزيغ الصبغي Chromosomal Aberration : هو شذوذ في عدد أو شكل الصبغيات .

    34.نسيلة Clone : هي مجموعة من الخلايا لها نفس البنية المورثية ومشتقة كلها من خلية واحدة عن طريق انقسام فتيلي متكرر .

    35.رامزة Codon : وهي ثلاثة نوكليوتيدات متجاورة في حمض نووي ، ترمز عادة " أي تكون بمثابة الشيفرة " لحمض أميني واحد .

    36.التوافق Concordance : ظهور نفس السمة في كلا فردي التوأم .

    37.خبن Deletion : ضياع جزء من الكروموزوم .

    38.ارتباط Linkage : هو ارتباط قطعتي DNA متتاليتين ، وقريبتين من بعضهما على الصبغي دون أن يكون بينهما علاقة مورثية ، مما يؤدي إلى اتصالهما معاً معظم الأحيان أثناء الانقسام الخلوي .

    39.عدم توازن ارتباطي Linkage disquilibrium : هو ترافق ألائل معينة في موضعين متصلين بشكل أكثر تواتراً لما هو متوقع عن طريق الصدفة .

    40.عدم انفصال Non – disjunction : فشل زوج من الصبغيات في الانفصال أثناء الانقسام الخلوي مما يؤدي إلى مرور كلا الصبغيين إلى نفس الخلية الابنة .

    41.جينات الأورام Oncogenes هي جينات تساهم في النمو غير السوي للخلايا السرطانية عندما يحدث تغيير في بنيتها أو في التعبير عنها.

    42.البلاسميد Plasmid : هو جزيء DNA بسيط دائري الشكل ، يستخلص من الجراثيم ، ويمكن تعديله واستخدامه كناقل أو حامل " Vector " لإنسال ال DNA .

    43.تفاعل سلسلة البولي ميراز Polymerase chain Reaction " PCR " : وهي تقنية تستخدم من أجل التحليل السريع لل DNA ، حيث تصنع قطع أولية " Primers " ذات عدد قليل من النوكليوتيدات ، متشابهة في تسلسلها مع كلا نهايتي ال DNA المستهدف ، ثم يتم تضخيم هذه القطع إلى ال DNA المجيني باستخدام أنزيم DNA بولي ميراز .

    44.الإنسال الموضع ( الوراثة المعكوسة ) Positioned Clonning ( Reverse Genetics ) : : وهي طريقة تستخدم لعزل الجينات ذات المنتجات البروتينية الغير معروفة ، ولكن يستدل على وجودها من خلال النمط الظاهري الذي يسببه وجودها .

    45.الرحلان الكهربائي الهلامي بالحقل النابض : Pulsed Field gel electrophoresis : وهي تقنية تستخدم لعزل القطع الكبيرة من ال DNA .

    46.RNA بولي ميراز : الأنزيم الذي يصنع ال RNA اعتماداً على قالب ال DNA .

    47.تشذيب Splicing : إزالة الانترونات من جزيء ال RNA غير الناضج ووصل الإيكسونات مع بعضها .

    48.انتساخ ( نسخ ) Transcription : العملية التي يتم من خلالها تصنيع جزيء ال RNA باستخدام قالب من ال DNA ، وغالباً بواسطة إنزيم ال RNA بولي ميراز .

    49.ترجمة Translation : العملية التي تم من خلالها ترجمة المعلومات الوراثية الموجودة على جزيء ال RNA المرسال وتحويلها إلى تصنيع للبروتين .

    50.الإزفاء Translocation : هو انتقال قطعة من أحد الصبغيات إلى صبغي آخر غير مشابه له ، ( كانتقال قطعة من الصبغي السادس مثلاً إلى الصبغي الرابع عشر ) .

    51.RNA الناقل (( RNA t )) Transfer RNA : هو جزيء RNA يحمل حمض أميني واحد ( بحسب مضادة الرامزة " Anti – Codin " التي يحملها ) والذي يجلب هذا الحمض الأميني إلى الريبوزوم أثناء عملية تصنيع البروتين .

    52.الناقل ( الحامل ) Vector : هو جزيء DNA (( مثل عاثية الجراثيم ، أو البلاسميد )) ، يستخدم لحمل بعض قطع ال DNA ذات الاهتمام .

    53.Synteny : مصطلح يستخدم لوصف الجينات الموجودة على الصبغي نفسه .

    54.cDNA : هو ال DNA المصنع بشكل معكوس ( أي ليس اعتماداً على قالب من ال DNA نفسه وبواسطة عملية المضاعفة بواسطة ال DNA بولي ميراز كما هي العادة في معظم أحوال تصنيع ال DNA ) وإنما يصنع اعتماداً على قالب من ال RNA المرسال “ mRNA " وبواسطة الإنزيم الناسخ العكوس " Revers Transcriptase " .

    1. التهجين Hybridization : كثير من خطوات تحليل ال DNA المؤشب تأخذ أفضلية الطبيعة المتممة للتفاعل المتبادل بين الحموض الأمينية والتي هي ضرورية لتركيب D NA و RNA . يمكن أن تعالج القطع الخطية لل DNA ذو البنية الخيطية المزدوجة بالحرارة أو بالقلويات لتفكيك الخيطين لينتج DNA وحيد الخيط ( الممسوخ ) . وعندما يحضن الخيط تحت ظروف تسمح بتهجين الحموض النووية فإن أسس ال DNA الممسوخ تميز الأسس المتممة ويحدث إعادة تشكيل للجزيئات الخيطية المزدوجة بازدواج الأسس .

    - إن تهجين الحموض النووية حساس جداً ذلك أن جزيئة DNA وحيدة الخيط يمكن أن تهجن بشكل خاص مع خيط متمم من RNA أو DNA موجودة في حوالي جزء واحد من ( 10000 ) جزء . إن الكثير من الدراسات على DNA المؤشبة تتضمن تحضير خيط واحد من الحموض النووية مشعع أو موسوم بالبيوتين والذي يستخدم بعد ذلك كمسبار في عملية التحليل . من الممكن تحديد هوية وتمييز السلاسل المتماثلة بشكل كامل أو المتماثلة بشكل جزئي ، إن خاصية تهجين الحموض النووية ، غالباً بالاشتراك مع إجراءات التجزيء أو التضخيم ، تسمح بكشف جينة مفردة من بين عشرات الآلاف ، أو كشف سلسلة من عضوية مخموجة ، والتي يمكن أن تظهر بتواتر أقل من نسخة واحدة لكل خلية بشرية ، يتضمن التنوع في تهجين الحمض النووي استعمال النيكليوتيدات القليلة نوعية الأليل ( ASO ) . إن مسبار ASO هو نيكليوتيد قليل مفرد الخيط تركيبي يتألف عادة من ( 15 – 20 ) أساس . يوجد مسباران تركيبيان ، عادةً يختلفان في مكان الطفرة بأساس واحد فقط ، المسبار الأول يتزاوج بإحكام مع السلسلة الطبيعية والآخر يتزاوج بإحكام مع السلسلة الطافرة ، مع وجود نيكليوتيد متنوع في الجزء المتوسط من النيكليوتيد القليل . إن حالات التهجين منظمة ولذلك فالنيكليوتيد القليل يكشف بالضبط السلسلة الملائمة ولكن يفشل بالتهجين إذا كان هناك سوء تلاؤم بأساس واحد فقط . يمكن أن تستعمل النيكليوتيدات القليلة نوعية الأليل بالاشتراك مع اختبار البقعة الجنوبي أو بالاشتراك مع تضخيم DNA .

    1. اختبار البقعة الجنوبي Southern Blotting :

    لقد استفادت تحليلات كثيرة للمجين البشري من إجراء اختبار البقعة الذي طوره ( ف . م . ساوثرن ) والذي يتضمن تهجين ال DNA في المحلول إلى DNA منقول إلى غشاء خلوي داعم . من أجل التحليل السريري ، يبدأ اختبار البقعة الجنوبي بعزل DNA المجيني من أي مصدر ، وهذا المصدر هو عادة الكريات البيض المحيطية أو الخلايا الجينية ، يهضم ال DNA المجيني ذو الوزن الجزيئي المرتفع بواسطة أحد إنظيمات الضبط منتجاً سلسلة من الشدف القابلة لإعادة التكاثر ، تفصل شدف ال DNA هذه بواسطة الرحلان الكهربائي في هلام الأغاروز ، وينقل ال DNA بعد ذلك من الهلام من خلال فعل الأنبوب الشعري الموجود في جهاز الاختبار إلى غشاء خلوي يرتبط مع DNA بشكل متين . يعالج الغشاء بعد ذلك ليقوم بنسخ DNA ثم ينقع في محلول يحوي مسبار حمض نووي وحيد الخيط مشعع أو موسوم . سيشكل المسبار معقد الحمض النووي مزدوج الخيط على مواضع على الغشاء حيث يوجد ال DNA المماثل . يغسل الغشاء ليتم إبعاد الاشعاعات غير المرتبطة وتكشف المواضع على الغشاء حيث سلاسل DNA المتماثلة متصلة باستعمال فيلم الأشعة السينية . إن حساسية اختبار البقعة الجنوبي تعزز بتقسيم ال DNA إلى شدف صغيرة ثم تقسيم الشدف وتطبيق طرق كشف حساسة لتبيان شدفاً بعينها ( تهجين الحموض النووية ) ، علاوة على ذلك يمكن أن تكشف هذه الطريقة شدف DNA المجين المفردة والتي تظهر نموذجياً حوالي جزء من مليون جزء في المجين . إن القوة السريرية لاختبار البقعة الجنوبي تتأتى من الوساعة في تحليل جزء صغير جداً من البنية الأولية ل DNA المجين البشري المأخوذ من شخص ما .

    إن هذا الاجراء مثالي لكشف إعادات الترتيب الضخمة في ال DNA ، ولتمييز بعض الطفرات النقطية ، ولكن معظم الطفرات لاتكشف باختبار البقعة الجنوبي الروتيني .

    1. اختبار البقعة الشمالي Northern Blotting :

    عبارة عن إجراء مشابه للسابق يبدأ بال RNA ، في هذا الاجراء يمكن تحديد وجود أو عدم وجود والحجم التقريبي ل mRNA معين .

    1. اختبار البقعة المناعي أو اختبار البقعة الغربي Western Blotting :

    وهو إجراء مشتق مصمم لتحليل المستضدات البروتينية ، تفصل البروتينات بالرحلان الكهربائي وتنقل إلى غشاء صلب من خلال إجراء اختبار البقعة ، بحلل الغشاء بحضانته مع الأضداد متبوعاً بخطوة ثانية للكشف الإنظيمي أو الإشعاعي للضد المرتبط . لذلك اختبار البقعة الجنوبي ، اختبار البقعة الشمالي ، واختبار البقعة المناعي أو اختبار البقعة الغربي كل واحد يضم طريقة كشف وتقسيم ليزود بتقنية حساسة لتحليل ال DNA ، RNA ، والبروتين على التوالي .




    1. الجملة الواسمة : عديد الأشكال الشدفي المجزوء ( المقصور ) Restriction Fragment Length Polymorphism ( RFLP ) : نظراً إلى أن عديد الأشكال يميز بحجم الأشرطة المشاهدة على البقعة الجنوبية ، وهو ليس عديد أشكال مفيد جداً لأن هناك احتمالين فقط يعتمدان على وجود موضع القصر أو غيابه كما أن هناك فرصة أولوية قوية لوجود السلسلة الواسمة نفسها على كلا الصبغيين ، وعديدات الأشكال الأكثر أهمية هي تلك المعتمدة على VNTRs حيث يوجد عدد كبير من الألائل المختلفة ، وحيث تكون فرصة الصبغيين المثليين في اكتساب واسمات مختلفة عالية . وتستخدم معظم طرائق تعقب التوابع الصغرية حيث تكون وحدة التكرار هي ثنائي النوويد : السيتوزين والأدنين . وتجري دراسة عديد أشكال التابع الصغري عادة بطريقة تضخيم البسر ومعاينة حجم سلسلة التكرار على هلامة عديد الأكريلاميد .

    1. أضداد وحيدة النسيلة Monoclonal Antibody :

    - إن تقنية الأضداد وحيدة النسيلة أحدثت ثورة تطورية في دراسة جزيئات سطح الخلية سواء في العضو الهدف ( المستقبل و المتأثر ) أو في الخلايا المنظمة للاستجابة المناعية ، ومنحتنا كواشف خاصة بكل جزيئة تقريباً. إن عزل وتنسيل وتحديد تسلسل وترتيب المورثات الخاصة بمستقبلات المستضدات والجزيئات المصاحبة لها على الخلايا التائية والبائية ، إضافة إلى تحديد المخطط الخاص ببنية جزيئات معقد التلاؤم النسيجي ( MHC ) كل ذلك أتاح لنا الحصول على كل المعلومات الضرورية لفهم كل من وظيفة التعرف بالخلايا المناعية ودور المستقبل في ذلك .

    - قاد التطور الحاصل في مجال تقنية الأضداد وحيدة النسيلة إلى اكتشاف كمية كبيرة من الجزيئات الجديدة على سطح الكريات البيض وأدى المؤتمر الدراسي الدولي الذي عقد في عام 1982 لبحث موضوع المستضدات الممايزة للكريات البيض إلى إطلاق وتأسيس مصطلحات خاصة بالجزيئات السطحية على الكريات البيض الإنسانية ، ثم انبثق تصنيف CD للمستضدات الممايزة للكريات البيض .

    - إن القدرة على انتاج أضداد وحيدة النسيلة المرتبطة بمستضدات نوعية قادت إلى إمكانية استخدامها في علاج السرطان ، وعلى الرغم من أن أضداد وحيدة النسيلة أداة هامة في تشخيص السرطانات فإن استخدامها في علاج السرطانات مازال قيد البحث ، وإن محاولات استخدام الأضداد وحيدة النسيلة وغير المرتبطة بشكل مشابه لاستخدام العلاج السام للخلايا أدى إلى نتائج مخيبة للأمال ، وكانت الصعوبات في تحديد المستضدات النوعية الورمية مصلياً ، وإن الجهود في تحسين هذه التجارب قادت إلى كشف الأضداد المرتبطة بالأدوية والنظائر المشعة والسموم ، كما أن الدراسات السريرية مفيدة في تقييم استخدام أضداد وحيدة النسيلة في تطهير نقي العظم من الخلايا السرطانية قبل القيام بعملية زرع النقي .

    - وإن الأنماط المناعية للمفومات وللإبيضاضات باستخدام أضداد وحيدة النسيلة الموجهة مباشرة ضد Myeloid ( نقياني ) ومستضدات اللمفاويات حسنت من فهمنا للآليات المرضية لهذه الأمراض وسهلت تشخيصها وأصبح من الشائع الآن تحليل النمط المناعي لكل أشكال Lymphoid ( لمفاني) و Myeloid (نقياني ) . وإن المقايسة المصلية المعتمدة على أضداد وحيدة النسيلة أصبحت شائعة الاستعمال في مراقبة المرض وتطور الأورام الصلبة .

    مثلاً : CA-125 يمكن استخدامه في مراقبة السرطانات المبيضية ، والمستضد النوعي للبروستات PSA يستخدم لمراقبة سرطان البروستات ، ويبقى الاستخدام الواسع ل PSA كأداة لمسح الإصابة الورمية للبروستات قيد الجدل








    --------------------------------------------------------------------------
    علم الهندسة الوراثية

    مقدمة في علم الهندسة الوراثية
    حتى تاريخ 1970 ميلادية كان إجراء الأبحاث على الحمض النووي ( الدي إن أي)من أصعب الأمور التي كانت تواجه علماء الوراثة و الكيمياء.و كانت معظم الأبحاث تجرى بشكل غير مباشر على الحمض النووي الريبوزي (الأر إن أي)أو البروتين.و لكن الحال تحول بشكل كامل فأصبح علم الوراثة المتعلق بفحص الدي إن أي(و المعروف بعلم الوراثة الجزيئية)من أسهل العلوم و أكثرها تطورا.لقد أصبح من السهل صنع نسخ عديدة من أي جين (مورث) أو مقطع محدد من الدي إن أي.كما أمكن معرفة تسلسل الأحماض النووية بسرعة تتعدى المئات في اليوم الواحد.كما استطاع العلماء استكشاف الجينات الموجودة في على الكروموسومات كما استطاعوا تغيير و تعديلها بشكل الذي يريدون و ليس هذا فحسب بل استطاعوا أن يعيدوا هذه الجينات المعدلة إلى الخلية و غرزها في الكروموسوم الذي يريدون.كما أمكن إنتاج كميات كبيرة من البروتينات كالهرمونات و اللقاحات المختلفة و التي كانت تنتج في السابق من الجثث الميتة أو تستخلص من الحيوانات و التي كانت تحوفها المخاطر من انتقال العدوى إلى الإنسان.كما أن هذه الثورة العلمية فتحة المجال أمام الكثيرين من محبي هذا العلم في اختراع و اكتشاف طرق جديدة و حديثة في التعامل و حفظ و تغيير هذه المادة الحيوية في الإنسان و الحيوان و النبات.لقد غير هذه العلم المنطلق كالصاروخ الكثير من المفاهيم الطبية و التي دفعة كثير من كليات الطب إلى تعديل مقرراتها لتزويد طلابها بالمزيد من هذا العلم. لقد أُطلق على عملية نسخ و تعديل و زرع الجينات اسم الهندسة الوراثية و هو اسم عام لا يحدد فكرة معينة أو تقنيه محدده، ولكنه يعني بكل ما يقام به في تغيير أو تعديل المادة الوراثية.و يتفرع من هذا العلم الكثير من التقنيات و هي متناثرة و موزعة على الكثير من فروع الطب و العلوم.و ليس للحصر إليك أهم 6 تقنيات تختص بالهندسة الوراثية:
    1-قص و قطع الحمض النووي(Cleavage of DNA ) بمقصاة خاصة تسمى (Restriction Nucleases )و اكتشاف هذه المقصاة ساعد كثيرا في مهمة التحكم في الدي إن أي.
    2- فصل قطع الدي إن أي على لوح من الجل بالكهرباء (Gel Electrophoresis ).
    3-معرفة التسلسل النووي(DNA sequencing ) لكل قطع الدي إن أي التي يتم عزلها بشكل سريع و دقيق.و التي تسمح للعلماء معرفة التركيب الإنشائي للجينات و معرفة و استنتاج نوع البروتين الذي ينتج منه.
    4- تقنية تهجين الحمض النووي(Nucleic acid hybridization )، و التي مكنتنا في معرفة أحجام القطع من الحمض النووي و الكشف عن القطع المحددة من الحمض النووي في خليط معقد من القطع المتشابهة.
    5-استنساخ الدي إن أي(DNA cloning )، و التي تسمح بإنشاء نسخ عديدة و متطابقة من القطع الدي إن أي.
    6-تقنية هندسة أو تعديل الدي إن أي (DNA engineering )، و التي تسمح بإنتاج نسخة معدلة من جين ما ثم أعادته مرة أخرى إلى الخلية.
    الإنزيمات القاطعة وقص ال DNA

    قص و قطع الحمض النووي:
    كما هو معروف فان البروتينات موجودة داخل الخلية على شكل قطع منفصلة عن بعضها البعض و هذا بالطبع سهل عملية فصلها عن بعضها البعض بطرق فنية مناسبة.ولكن الجينات موجودة على الكروموسومات على شكل حبات متصلة ببعضها البعض و ليست على شكل قطع منفصلة.وهذا التسلسل و الترابط في الجينات جعل عملية فصله و عزل و استخلاص جين محدد من بقيه الجينات مهمة صعبة ان لم تكن مستحيلة قبل عام 1970.
    ولكن اكتشاف الإنزيمات القاطعة(Restriction Nucleases ) ساعد في عملية استخلاص الجينات و قطع الدي ان أي و نسخها .
    الإنزيمات القاطعة (Restriction Nucleases )
    لا شك أن كل كائن حي لديه طرق دفاع مختلفة تحميه من غارات الأعداء و هجوم المعتدين! و البكتيريا هي إحدى هذه الكائنات و لها أعداء كثر و من أهم أعدائها الفيروسات المختلفة.و لقد قامة بعض من البكتيريا بإنتاج خمائر(إنزيمات) مهمتها تدمير الفيروسات.و من هذه الإنزيمات الإنزيمات القاطعة أو (Restriction Nucleases).و تقوم هذه المقصاة أو القواطع بقص الحمض النووي(الدي إن أي)للفيروس و بذلك يشل عمله و يبطل مفعولة. و بما أن الدي إن أي مادة موجودة بشكل طبيعي في البكتيريا كما هو الحال في الفيروسات و الكثير من الكائنات الحية فان هذه المقصاة قد تشكل خطرا على البكتيريا نفسها في قصها لدي إن أي الخاص بها.ولكن هذا لا يحدث و السر في ذلك هو قيام البكتيريا بتحوير أجزاء من الدي إن أي الخاص بها عن طريق إضافة مجموعة الميثيل( Methyl) إلى بعض الأحماض النووي من نوع الادنين او السيتوسن(Methylation at an A or a C residue ) فلا يستطيع المقص أو القاطع من قص الحمض النووي الخاص بالبكتيريا.و عند اكتشاف هذه القواطع في السبعينيات الميلادية بدأ العلماء في استخدامها كمقصاة لقص الدي إن أي .و ساعدتهم هذه المقصاة في عملية التحكم في الدي أن أي.و يوجد حاليا أكثر من مائه نوع من هذه المقصاة.و تقسم هذه المقصاة إلى نوعين رئيسيين، النوع الأول يقص شريط الدي إن أي المزدوج بشكل رأسي مستقيم(Blunt ends) و النوع الثاني يقص بشكل متعرج(Staggered cuts, ) و بتالي يجعل طرفي الدي إن أي المقطوع مادة قابلة 'للزق'قطعة غريبة من الدي أن أي فيها.و عن لزق قطعة من الدي إن أي في داخل الفراغ الناتج من القطع ينتج لنا قطعة مركبة من قطعتين مختلفتين من الدي إن أي و هذه القطعة تسمى دي إن أي مهجّن أو (Recombinant DNA).
    كيف يتعرف الإنزيم القاطع على المكان المفترض أن يحدث القطع فيه؟
    كل إنزيم قاطع يعتبر عن مقص خاص لقطع الدي إن أي في نقطة محددة.و يتعرف الإنزيم القاطع على مكان القطع حسب تسلسل الدي إن أي للقطعة.فكل إنزيم قاطع يقطع في تسلسل محدد.فمثلا الإنزيم القاطع المعروف بالهيبا و احد(Hpa I )يقطع عندما يجد 6 من الأحماض النووية في هذا التسلسل ( GTTAAC) بينما الإنزيم القاطع إيكو أر واحد (Eco RI ) يقطع عندما يجد 6 من الأحماض النووية في هذا التسلسل( GAATTC).و للمعلومية فان هيبا واحد سمي بهذا الاسم لأنه يوجد في بكتيريا الهيموفلس بارا انفلونزا (Hemophilus parainfluenzae ) و هذا الإنزيم يعتبر من الإنزيمات التي تقطع بشكل رأسي مستقيم.بنما انزيم الايكو ار واحد فهو مأخوذ من بكتيريا الايكو كولي (Escherichia coli )، ويعتبر من الإنزيمات التي تقطع بشكل متعرج.
    تسلسل مواقع القطع Recognition Sites لبعض الإنزيمات القاطعة
    الإنزيم القاطع المصدر المقطع الذي تُميزة
    BamHI Bacillus amyloliquefaciens H GGATCC
    EcoRI Escherichia coli RY13 GAATTC
    HaeIII Haemophilus aegyptius GGCC
    HindIII Haemophilus influenzae Rd AAGCTT
    HpaI Haemophilus parainfluenzae GTTAAC
    HpaII Haemophilus parainfluenzae CCGG
    MboI Moraxella bovis GATC
    NotI Nocardia otitidis-caviarum GCGGCCGC
    SfiI Streptomyces fimbriatus GGCCNNNNNGGCC
    TaqI Thermus aquaticus TCGA
    القطع المحددة (Restriction fragments ):
    عندما يضاف الإنزيم القاطع إلى محلول به شريط من الدي إن أي فانه يقطّعه إلى عدة قطع و ليس إلى قطعتين فقط.و كل قطعة مقطوعة بالإنزيم تسمى قطعة محددة.و يختلف طول هذه القطع على حسب المسافة التي بين كل مقطع و أخر.و لكن يجب أن تكون كل قطعة محددة لها نفس الحجم في كل نوع من الكائنات الحية.و ذلك يعني أن جميع الناس(الإنسان)لديه قطعة محددة معينه يقطعها الإنزيم القاطع هيبا واحد في الكروموسوم رقم 2.و يمكن التأكد من ذلك بتحليل قياس لهذه القطعة بتقنيه حركة الدي إن أي الكهربائية على الجيل(انظر موضوع حركة الدي إن أي الكهربائية في الجل( Gel Electrophoresis).و إذا لم حدث أن وجد إنسان ليس لديه نفس الحجم المفترض للقطعة ففي هذه الحالة نستنتج أن هذا الشخص لدية طفرة(تغير في تسلسل الدي إن أي)في احد الأماكن التي كان من المفترض أن يقصها الإنزيم فلم يتم القطع فيها.و بذلك فان حجم القطعة قد اختلف تعرف هذه الظاهرة عند علماء الوراثة بتفاوت القطع المحددة المصحوب بطفرة(Restriction Fragment Length polymorphism. RFLP )


    خريطة القطع المحددة RFLP's Map
    لقد أنشاء العلماء خريطة تسمى خريطة القطع المحددة لكثير من الكائنات الحية.و هذه الخريطة تبين مكان القطع و محلها مقارنة بالقطع الأخرى .و عملت هذه الخريطة عن طريق تقطيع جميع الكروموسومات بإضافة أنواع مختلفة من الإنزيمات القاطعة ثم رتبت هذه القطع بشكل منتظم.و كان الهدف من هذه الخريطة هو لتحديد نقاط و علامات على طول الشريط الطويل من الدي إن أي التي تتركب منه الكروموسومات و لكي يستطيعوا أن يقارنوا بين هذه القطع في الكائنات المختلفة.

    خريطة للقطع المحدودة لـليمبدا فيج و فيروس الادينوفيرس.توضح مواقع القص لثلاث أنواع من الإنزيمات القاطعة BamHI, EcoRI, and HindIII ))

    قطعة بطول 48ز5 كيلوبيس من البكاتريوفيج ليمبدا()قطع بالإنزيم القاطع ايكو واحد في خمس أماكن و نتج عنه ست قطع متفاوتة الطول و الحجم.و لقد وضعت هذه القطع على لوح من الاقروز و فصلة و اخرج حجمها كما هو موضح في الشريط الأسود في أسفل الصورة.
    فصل قطع الدي إن أي على لوح من الجل بالكهرباء
    استعمل العلماء تقنية فصل البروتينات عن بعضها البعض بطريق انتقالها(رحلان) و انفصالها عن بعضها البعض، و ذلك عن طريق تعريضها إلى تيار كهربائي و هي على لوح من المادة الهلامية المعروفة بالجل.ولقد استعمل العلماء نفس الفكرة في فصل قطع الدي إن أي عن بعضها البعض.ومن المعروف أن الحمض النووي عبارة عن شحنة سالبة و لذلك فعند و ضع بعض من الدي إن أي في طرف من أطراف لوح الجيل ثم وتعريضها لتيار كهربائي بحيث يكون القطب السالب عند الطرف الذي وضعنا فيه الدي إن أي و القطب الموجب عن الطرف الأخير من ألواح فان الدي إن إي ينتقل تلقائيا بتجاه الطرف الذي فيه
    القطب الموجب و تتوقف حركة قطع الدي إن أي على حسب إحجامها على طول اللوح.فالقطع الصغيرة تتحرك بشكل اكبر من القطع الكبيرة. و بذلك يمكن فصل هذه القطع عن بعضها البعض.و يمكن تحديد ا لحجم الفعلي لكل قطعة عن طريق إضافة قطع معروفة الحجم من الدي إن أي و التي تكون مقياس يرجع إليه لاستنتاج أحجام القطع.
    وهناك نوعان أساسيان من ألواح الجيل.الأول يسمى بجيل الاقروز (Agarose gel ) و الثاني بجيل البولي اكريليميد(Polyacrylamide gel ).و نظرا لصغر الفراغات التي بين البولي اكريليميد فانه يستخدم لفص القطع الصغيرة الحجم من الدي ان أي و في العادة التي تكون اصغر من 500جزيء من الحمض النووي و التي تتفاوت بين بعضها البعض بجزيء أو جزيئين (انظر الرسم A)..بينما يستخدم الاقروز للأحجام الأكبر من الدي إن أي. و التي يتراوح حجمها بين 300 إلى 10000 جزيء من الدي إن أي (انظر الرسم ..ومادة الاقروز هي مادة سكرية مستخرجة من الطحالب و عند تحضيرها فإنها تشبه في قوامها الجيلاتين الذي نأكله و لكنها أقوى في قوامها بعض الشيء و لكنها قابلة للتهتك أو الانقطاع عند نقلها بغير حرص.
    و لقد واجهه العلماء صعوبات في فصل القطع الكبيرة من الدي إن أي و ذلك لان هذه القطع و عند وضعها على جيل الاقروز و بعد تسليط التيار الكهربائي عليها تتوقف لأنها تتمدد بشكل متعرج على شكل ثعبان ملتوي طرف باتجاه القطب السالب و الأخر بتجاه القطب الموجب.و لقد حلت هذه المشكلة عن طريق تعريض جل الاقروز إلى مستويات متفاوتة من القوة الكهربائية على طول اللوح و بذلك فان قطعة الدي إن أي الطويلة عندما تتعرض إلى تيار كهربائي مختلف يجعلها تعدل من تمددها المتعرج قبل أن تدخل في التيار الكهربائي الجديد و يستمر هذا التفاوت في التيار و التعديل في قوام القطعة حتى تصل إلى المكان الذي يجب أن تقف فيه حسب حجمها. و يسمى هذا النوع من الفصل بالفصل عن طريق المجال الكهربائي المتردد (Pulsed-field gel electrophoresis ).و أمكنت هذه التقنية من فصل قطع كبيرة من الدي إن أي و حتى فصل قطع من الكروموسومات على الجل و تتراوح القطع التي يمكن فصلها بهذه الطريقة بين 220000 إلى 2.5 مليون جزيء من الدي إن أي (انظر الرسم C).
    لا تكون القطع المفصولة بالبولي اكريليميد و الاقروز واضحة للعيان و لذلك فان لوح الجيل يعرض إلى مادة لصباغة الدي ان أي و اشهر هذه المواد هو مادة برميدات الاثيديوم ( Ethidium Bromide )و التي تلمع عند تعريضها للأشعة فوق البنفسجية.و هناك طريقه أكثر دقه لمشاهدة القطع على لوح الجيل و هذه الطريقة تعتمد على إضافة مادة مشعة نووية إلى الدي إن أي قبل أن يوضع على لوح الجيل و لكن هذه الطريقة تحتاج إلى احتياطيات معينه لكي لا تضر بمن يستخدمها.
    معرفة التسلسل النووي(DNA sequencing )
    لا شك أن العلماء يحتاجون إلى معرفة التركيبة التسلسلية لكل جين و هذا يمكنهم من معرفة المزيد عن البروتين الذي يصنعه ذلك الجين وعن التركيبة التنظيمية لعمل الجين و قد يصلون على ضوءه إلى معرفة الأمور التي تتحكم في عمله.كما انه بمعرفة التسلسل النووي للجين يمكن مقارنته بالجينات التي سبق اكتشافها و هذا قد يعطي معلومات غزيرة عن وضيفة هذا الجين و يختصر الكثير من الابحاث
    و يتجنب اعادة اجرائها.وهناك طريقتان أساسيتان لمعرفة التسلسل النووي لأي قطعة من الدي إن أي.الأولى تسمى بالطريقة الإنزيمية (Enzymatic method ) و الأخرى بالطريقة الكيميائية(Chemical ).و لقد طغت الطريقة الأولى حتى أصبحت هي الطريقة الأكثر استعمالا.
    الطريقة الإنزيمية (Enzymatic method ):
    يطلق على هذه الطريقة أيضا طريقة سنجر (Sanger procedure )نسبة إلى د.فريدريك سنجر و الذي أسس هذه الطريقة.كما أنها أيضا تعرف التسلسل عن طريق دي ديوكسي (dideoxy sequencing).و تترتكز هذه الطريقة على مفهوم أن شريط الدي إن أي في الأساس مبنى من جزيئات من الديوكس

    يختلف الديوكسي نيوكلويتيد عن دي ديوكسي بيوكلوتيد بعدم و جود مجموعة (هيدروكسي)في النقطة الثالثة من حلقة السكر الخماسية الشكل.
    نيوكلويتيد (deoxynucleotides (dNTPs )و يوجد على النقطة الثالثة من حلقة السكر الريبوزي مجموعة مؤكسدة أي مجموعة هيدروكسيه( OH)و هذه النقطة هي التي ترتبط في النقطة الخامسة من الجزيء الذي يليها و هكذا يتم الترابط لتكوّن شريط طويل من الدي إن أي.و لقد قام د.ستنجر بالاستفادة من هذه الخاصية فبدّل الجزيء من (OH)إلى (H ) عن طريق إضافة دي ديوكسيو بيوكلوتيد(ddNTPs) بدل من ديوكسي نيوكلوتيد(dNTPs ) و ذلك عن طريق نسخ الشريط مرة أخرى و هذا يؤدي الى توقف ترابط الجزيئات و يكون في طرف كل جزيء نوع واحد من الأحماض النووية.
    و إليك الخطوات الأساسية للقيام بهذا الاختبار بالترتيب:
    1- القيام بنسخ الدي ان أي و ذلك على الشكل التالي:
    أ- أضف إلى عينة الدي إن أي قطع من البريمر(specific primer)يعرف انه سوف يلتصق بالدي إن أي المراد نسخة و معرّف(ملتصق بطرفة) بعنصر مشع.
    ب- قسم العينة إلى أربع أنابيب اختبار و كل أنبوبة اكتب عليها السماء التالية (dGTP, dATP, dCTP, and dTTP)..
    ج- أضف إنزيم البولمريز ( DNA polymerase)
    د-أضف إلى كل أنبوبة نوع واحد من الدي ديوكسي نيوكليتيد حسب اسم الأنبوب.و أضيف معه كمية من ديوكسي نيولكليتيد.سوف يحدث التفاعل و يبداء البريمر ببنان و تركيب و رص هذه الأحماض النووية.وعند إضافته لدي ديوكسي نيوكليتيد فان الشريط يتوقف على هذه النقطة.ثم يحدث تفاعل أخر لنسخ شريط أخر و عند إضافة دي ديوكسي نيوكليتيد يتوقف التفاعل و هكذا تستمر العملية و ينتج عندي في النهاية قطع منسوخة و متفاوتة الطول في كل أنبوب اختبار.
    2- أضيف كمية من كل الأربعة أنابيب في حقل خاص على لوح الاقروز ثم امرر تيار كهربائي و من ثم تظهر على طول اللوح القطع المنسوخة و المتفاوتة الأطوال كل حقل يعطيني ترتيب القطع.
    3-تعريضها للأشعة(Autoradiography) لكي يتسنى رؤية الدي إن أي و الذي عليه مادة مشعة.
    4- ابدأ بقراءة لوح الاقروز من أسفل إلى أعلى.وكل ما مر على نسخة من الدي إن أي اعرف ترتيب و نوع الديديوكسي نيوكليتيد الذي في طرفة و استمر في القراءة إلى أن ينتهي لوح الاقروز.
    و لتسهيل عملية القراءة استخدم الكمبيوتر لكي يقرأها بشكل إلي و ذلك بتعريض لوح الاقروز إلى أشعة ليزر و عن طريق وحدة استشعار و مضخم للنبضات (photomultiplier ) يستطيع الكمبيوتر أن يحدد نوع الدي ديوكسي نيوكليتيد و ثم يرتبها و يطبعها و يعطيك رسماً بيانياً لاماكن كل حمض نووي و بالألوان.و لا تستخدم المواد المشعة في القراءة الآلية بالكمبيوتر بل يستعاض عنها بمادة مضيئة(fluorescent ) توضع على البريمر على أن يكون لكل دي ديوكسي نيوكليتيد لون مختلف عن الآخر(أي أربعة ألوان من المادة المضيئة) و بذلك يمكن أن تمر جميع القطع في ممر واحد كما هو واضح في الرسم الجانبي. و نظرا إلى أن جهاز الكمبيوتر قابل للخطاء فانه يلزم التدقيق و المراجعة لتفادي حدوث الأخطاء.و لقد قامة أجهزة كمبيوتر عملاقة تعمل على مدار الساعة و تحت مظلة مشروع الجينوم البشري بالكشف الكامل(99% تقريباً)من التسلسل النووي لجميع الدي إن أي الموجود في الإنسان و قد سبق ذلك الكشف عن التسلسل النووي لكثير من الكائنات الحية و العمل جاري لمعرفة المزيد.
    الناقلات ( Vectors)
    الناقل و التي تسمى باللغة الإنجليزية 'فيكتور' هي في الغالب فيروسات أو قطع من الحمض النووي موجودة في البكتيريا.كما أن هناك أنواع صناعية تم صنعها في المختبرات الطبية و هي في العادة مواد شبه صناعية لأنها في الأصل مصنعة من مواد موجودة في الطبيعة.


    البلازميد
    و هي من اشهر الناقلات ،و هو عبارة عن قطعة صغيرة من الحمض النووي قابلة للتكاثر بمعزل عن بقية الحمض النووي الموجود في الكروموسومات .و هي شبيهة بالفيروس الصغير و لكنها لا تحتوي على طبقة خارجية من البروتين.
    . و البلازميد عبارة عن قطعة من الحمض النووي موجود في البكتيريا خاصة في الاي كولي(E.Coli) و بعض أنوع الخميرة ( Yeast) .و لدية القدرة على التكاثر الذاتي و بمعزل من بقية الكروموسومات
    الموجودة في الخلية.كما أن هناك بلازميدات تستطيع التكاثر داخل البكتيريا و الخميرة في آن واحد. و يوجد نوعان من البلازميد على حسب نوع الحمض النووي فيها فهناك البلازميد المصنوع من الدي إن أي (DNA ) و نوع أخر مصنوع من الأر إن أي (RNA ). و هناك أنواع عديدة من البلازميد فمنها الصغير و منها الكبير كما أن منها ما لا يحتوي على أي جين بينما هناك أنواع كبيرة تحتوي على عدة جينات.و بالإضافة إلى وحدة التكاثر الذاتي الموجد على البلازميد هناك الكثير من الجينات التي قد تكون على البلازميد و هي مفيدة للعلماء في عملية نسخ الجينات و القطع النووية فمثلا فد يوجد على البلازميد جين خاص يكافح المضادات الحيوية كالمبيسيلين و التترسيكلين .و هذه الجينات الحامية من المضادات الحيوية تساعد في التعرف و عزل البكتيريا التي تحتوي على البلازميد الذي عليه الجين الذي كنا ننوي استنساخه (للمزيد راجع عملية نسخ الجينات و القطع النووية)و يعتقد نظريا أن الفيروسات المنتشرة في الأصل كانت بلازميدات حيث أنها اكتسبت غلاف بروتيني خارجي و أصبحت فيروساً.

    أنواع البلازميد التي تنمو في خميرة الخبز



    YIP, yeast integrating plasmid = selectable marker +cloning sites
    YRP, yeast replicating plasmid = YIP + ARS origin of replication
    YEP, yeast expression plasmid = YIP + 2 micron origin of replication
    YCP, yeast centromere plasmid = YRP + centromere sequence

    الناقلات الفيروسية ( Viral Vectors) :
    إن اشهر هذه الأنواع هي الفيروسات البكتيرية المعروفة بالفيج ( Phage). و هي عبارة عن قطعة من الدي ان أي مغطاة بغلاف بروتيني. ومن اشهر أنواع الفيج ما يسمى بفيج لمدا (lambda phage) و هو فيروس موجود في الاي كولي E. coli. وهذا النوع من الناقلات تستطيع أن تحمل قطعة من الدي إن أي حتى غاية كيلوبيز.و لقد حوّرت هذه الفيروسات لكي تستطيع حمل كمية اكبر من الدي إن أي.فعلا سبيل المثال الكوزميد ( Cosmids ) عبارة عن تهجين جزء(قطعة من الدي ان تسمى اللاصقة cohesive sequence و تعرف مختصرة بالكوز Cos sequence) من فيج ليمبدا(Phage ) مع بلازميد (Plasmid ) و الذي يستطيع نقل حتى 40 كيلوبيز (40kb ) و الباك الفيروسي المسمى بكروموسوم بي 1 الصناعي (PAC P1-derived Artificial Chromosomes / ) عبارة عن تحوير للفيج بي 1 (P1 Bacteriophage ) و إضافته إلى البلازميد..
    Cos sequence from Lambda phage + Plasmid Cosmid
    P1 Phage + Plasmid PAC
    Modified E.coli fertility plasmid-factor BAC
    الناقلات الكروموسومية الصناعية (Artificial Chromosomes ):
    نظرا للحاجة إلى نقل إحجام كبيرة من الدي إن أي فقد قام بعض العلماء بتحوير بعض الناقلات الطبيعية لكي تقوم بهذه المهمة.و يوجد حاليا ناقلات على شكل كروموسوم و فيها القطع الأساسية لكي تعمل على شكل كروموسوم.و من هذه الأنواع ما يعرف بــ الياك او كروموسوم الخميرة الصناعي(Yeast Artificial Chromosomes / YAC ) و الذي يستطيع نقل أكثر من 500 كيلوبيز (500 kb ).و الياك عبارة عن قطعة من الدي ان أي مترابطة و تحتوي على طرفين للكروموسوم(2 Telomeres) و مركز للكروموسوم(Centromere) و مركز للتكاثر(Autonomous replicating sequence ARS).بينما الباك البكتيري(Bacterial Artificial Chromosomes / BAC )و الذي يستطيع حمل حتى 150 كيلوبيز (150 kb ) هو تحوير للبلازميد المعروف ببلازميد تناسل بكتيريا الايكولي(E.coli fertility plasmid-factor)).
    نوع الناقل Vector حجم الدي ان أي الذي يستطيع حملة
    البلازميد Standard plasmid 0- 10 KB
    لمبدا بكتيريوفيج محور Lambda Bacteriophage 0-23 Kb
    كوزميد Cosmid 30-44 Kb
    بكتريوفيج بي 1 Bacteriophage P1 70-100 Kb
    كروموسوم بي 1 الصناعي P1 P1Artificial chromosome PAC 130- Kb 150
    كروموسوم البكتيريا الصناعي Bacterial Artificial Chromosome BAC بحد أقصى 300 Kb
    كروموسوم الخميرة الصناعي Yeast Artificial Chromosome YAC 0.2-2 Mb
    النسخ والاستنساخ(Cloning):
    يشتهر بين الناس كلمة الاستنساخ نظرا لارتباطها بخلق الكائنات أو إنشاء نُسخ منها.و لكن بالمصطلح الطبي فان كلمة نسخ أو استنساخ تعنى عملية إنشاء صورة طبقا الأصل من المادة التي يراد نسخها.و قد يكون النسخ لقطعة من الدي إن أي أو نسخ كائن حي متكامل.و لا شك أن لغتنا العربية تفرق بين كلمة نسخ و استنساخ و لكننا سوف نستخدم كلمة نسخ أو استنساخ في حديثنا لنعني نفس الشيء. و في كلمة استنساخ باللغة العربية تعني ( Cloning)وينتج عنه نسخة أو مستنسخ (Clone).
    عندما قام الدكتور... و فريقه العلمي بنشر (Nature 385, 810-13, 1997 )خبر استنساخ النعجة 'دولي' في احد مختبرات اسكتلندا ( مختبر روزيلين ) عام 1997 زاد اهتمام العالم بموضوع الاستنساخ و زاد الفضول العلمي في الحديث عن استنساخ الإنسان و فجر ذلك الخبر الكثير من التحفظات الدولية من كثير من المراكز الدينية و العلمية على الجانب الأخلاقي من عملية استنساخ الإنسان.
    و بعد ذلك اخبر أصبحت كلمة استنساخ تستخدم بين العامة في الحديث عن عملية خلق نسخة أخرى من الحيوان أو الإنسان و بذلك بدأ البس بين الكثيرين في معنى هذه الكلمة.و لا شك فان العلماء كانوا و مازالوا يستعملون هذه الكلمة في الإشارة إلى عملية صنع نسخة من أي مادة وراثية و ليس بالضرورة خلق أو نسخ كائن حي بالكامل. و لذلك فالعلماء يقسمون الاستنساخ أو النسخ إلى 3 أنواع :
    1- نسخ أو استنساخ القطع من الدي إن أي عن طريق الهندسة الوراثية و بما يعرف بتهجين الدي إن أي ( Recombinant DNA technology ) .
    2- الاستنساخ التكاثري أو الجنسي Reproductive cloning
    3- الاستنساخ العلاجيTherapeutic cloning
    نسخ أو استنساخ القطع من الدي إن أي عن طريق الهندسة الوراثية.
    إن ما يهتم به العلماء في باب الاستنساخ هو نسخ قطع من الدي إن أي كانت هذه القطع عبارة عن جين(مورث)أو جميع الجينوم(أي كل الدي إن أي الموجود في الكائن الحي).و اشهر العمليات التي تجرى هي نسخ قطعة من الدي إن أي. و يحتاج العلماء للقيام بنسخ القطع لأنهم يحتاجون إلى كمية كبيرة من هذه النسخ و ذلك لندرة استخلاصها في كل مرة من داخل الخلية و ذلك لوجود التعقيدات الإنشائية للكروموسومات .و على سبيل المثال فان الجين المنتج لسلسة بيتا في الهيموجلوبين و المعروف بمورث ببيتا جلوبين( Beta-Globin Gene) يمثل فقط 0.00005% من حجم الدي إن أي الكلي في الخلية(و الذي يتراوح ب 3بلايين قاعدة نووية).كما أن الجين العملاق و المعروف بجين الدستروفين( Dystrophin Gene ) و الذي يتراوح حجمه بال2.5 ميقابيز (2.5Megabases ) لا يمثل أكثر من 0.08% من الحجم الكلي للدي إن أي في الخلية.و لذلك فان العلماء يحتاجون إلى إجراء نسخ لهذه الجينات أو القطعة من الدي إن أي لكي يتسنى لهم التعامل بها و إجراء التجارب عليها.و هناك طريقتان رئيسيتان للنسخ:
    1- النسخ عن طريق استخدام الخلايا الحية(Cell-Based DNA cloning)
    2- النسخ عن طريق غير الخلايا الحية(Cell-Free DNA cloning) و ذلك باستخدام البي سي أر( Polymerase chain reaction PCR).سوف نورد لهذه الطريقة صفحة مستقلة إنشاء الله.

    النسخ عن طريق استخدام الخلايا (Cell-Based DNA cloning)
    يرتكز النسخ باستخدام الخلايا الحية على ثلاث خطوات:

    1- تصميم قطعة مهجنة من الدي إن أي المراد نسخها و دي إن أي من ناقل (Vector) و لدية القدرة على التكاثر.و ذلك عن طريق استخدام الإنزيمات القاطعة(Restriction enzymes).

    1- Construction of recombinant DNA molecules by in Vitro attachment to Replicon(Vector).

    2- نقل القطعة المهجنة و التي هي بداخل الناقل إلى خلية حية و في العادة تستخدم البكتيريا(Bacteria ) خاصة النوع المعروف بالايكولي (E,coli او الخميرة( Yeast).

    2-Transformation using bacteria or yeast

    3- اختيار المستعمرات البكتيرية التي تحتوي على الناقل و القطعة المهجنة و السماح لها بالتكاثر.عن طريق أطباق الزراعة(Culture Plates) أو في محاليل سائلة.

    3- Selective propagation of cell clones.

    4-استخلاص القطع المهجنة و استخراج الدي ان أي منها بكميات كبيرة.

    3- Isolation of recombinant DNA clones
    1- تصميم القطع مهجنة من الدي إن
    يعتمد النسخ باستخدام الخلايا الحية على قدرة القطعة المراد نسخها على الانقسام أو التكاثر الذاتي عندما توضع داخل الخلية الحية.و لا شك أن قطع الدي إن أي العادية ليس لديها القدرة على التكاثر الذاتي و لذلك فان العلماء قاموا بتجاوز هذا الأمر بان ادخلوا القطعة التي يريدون نسخها في ناقل من النواقل( Vectors ) المعروفة بقدرتها على التكاثر الذاتي(راجع موضوع النواقل).و بغض النظر عن نوع الناقل فان طريقة إدخال قطعة الدي ان أي المراد نسخها إلى الناقل تقريبا واحدة.و هذه الخطوات ببساطة كما يلي:
    1- بعد أن يتم تحديد القطعة المراد نسخها يضاف إليها إنزيم قاطع محدد و ليكن مثلا إنزيم ( أ )فيقوم هذا الإنزيم بقطع الدي إن أي في مكان محدد حسب التسلسل النووي.
    2- يضاف نفس الإنزيم للناقل و الذي يقوم بقطعة أيضا في نفس التسلسل النووي.
    3- تضاف القطع المراد نسخها بعد قطعها بالإنزيم القاطع إلى الناقل المقطّع. فتتداخل التسلسلات النووية بين الناقل و بين قطع الدي إن أي المراد نسخها. فنشاء من ذلك قطعة مهجنة من الناقل و بداخله القطعة المراد نسخها.و ترتبط قطعة الدي إن أي البلازميد من أطرافها برابطة هيدروجينية و هي رابطة ضعيفة لذلك يضاف إنزيم يسمى ليقيز أو اللاصق(Ligase ) لكي يحول الترابط بين قطعة الدي إن أي و التناقل إلى رابطة قوية(Covalent Bond )
    إن أكثر لناقلات استخداما هي البلازميد و لكن يمكن استخدام الفيج أو الياك أو أي ناقل أخر.و الذي يحدد نوع الناقل المراد استخدامه هو في العادة كبر القطعة المراد استنساخها.ففي حالة القطع الصغيرة يستخدم البلازميد أو الفيج بينما يستخدم الياك أو الباك في حالة القطع الكبيرة.
    2- نقل القطعة المهجنة و التي هي بداخل الناقل إلى خلية حية
    في الغالب تستعمل البكتيريا خاصة النوع المعروف الايكولي(E.Coli) في عملية الزراعة و ذلك لسهولة إدخال الناقل إليها، و إلى سرعة انقسامها (تنقسم البكتريا تقريبا كل 20 دقيقة)، إضافة إلى توفر طرق الاختيار خاصة التي تعتمد على خاصة الحماية من المضادات الحيوية.و يدخل البلازميد أو الفيج تلقائيا إلى داخل البكتيريا بينما الناقلات الأخرى تحتاج إلى مساعدة ،و في العادة بتغيير تركيز الأملاح المحيطة بالبكتيريا أو تعرض إلى نبضة كهربائية لكي يسمح الجدار المحيط بالبكتيريا بدخول الناقلات.و من طبيعة البكتريا إنها تنقسم تلقائيا و بشكل سريع و كذلك البلازميدات.
    3- اختيار المستعمرات البكتيرية التي تحتوي على الناقل و القطعة المهجنة
    مع تكاثر الخلايا البكتيرية و تكاثر البلازميد التي بداخلها ينتج لدينا أعداد كثيرة من المستعمرات البكتيرية و بها البلازميد المهجن.و لكن قد يكون في داخل الطبق الذي زرع فيه البكتريا بعض البكتريا التي لا تحتوي على البلازميد المهجن و لكي يمكن التعرف على البكتيريا التي تحتوي على البلازميد المهجن فنه في العادة يقام باستعمال ناقلات عليها جينات واقية من المضادات الحيوية، كالجين الواقي من المضاد الحيوي امبيسيلين أو لاتترسيلين و غيرها. و بذلك فالمضاد الحيوي سوف يمنع تكاثر أي خلية بكتيرية لا تحتوي على البلازميد المهجن و الذي علي الجين الواقي من المضاد الحيوي.
    4- استخلاص القطع المهجنة و استخراج الدي ان أي منها بكميات كبيرة.
    بعد أن يُتعرف على المستعمرات التي تحتوي على البلازميد المهجن فانه يمكن نقلها إلى طبق جديد و يحافظ عليها و تغذى لكي تستمر بالتكاثر.و هذه البكتيريا يكون فيها أعداد كثيرة من البلازميد و بذلك تنتهي عملية النسخ.و يستفاد من هذه القطع المنسوخة في القيام بالمزيد من البحوث أو التجارب عليها كان يقام مثلا إنتاج مكتبة من الدي إن أي أو محاولة استنتاج التسلسل النووي للقطعة.كما يمكن تحوير هذه العملية بحيث يحتوي البلازميد على قطعة من سي دي إن أي(cDNA) بدل و من ثم تحوير المراحل الأخيرة من الزراعة لإنتاج بروتين بدلا من الدي إن أي. و هذه الطريقة هي التي تستعمل في إنتاج بعض الهرمونات كهرمون النمو
    التعديل الأخير تم بواسطة sonuci_2010 ; 20-10-2010 الساعة 04:09 PM سبب آخر: add vedio

  2. 20 أعضاء قالوا شكراً لـ sonuci_2010 على المشاركة المفيدة:

    محمد جيجاوي (29-12-2010), askar (20-11-2009), azizka71 (20-01-2009), مهر (23-01-2009), لولة البايو (19-01-2009), المُتيّم (08-12-2012), احلام الجوري (19-09-2011), Dana (27-08-2010), باحثة علمية (11-03-2010), بكالوريوس ميكروبيولوجي (25-12-2009), FBC (27-10-2009), FUAD ISMAIL (13-12-2010), HUMAN GENETICS (17-09-2010), miss biochemistry (02-02-2011), miss microbiology (11-01-2010), Relaxation (14-04-2010), soso^_^ (19-06-2012), trqziz (23-01-2009), yemen (26-12-2009), zxzxzx1990z (08-01-2012)

  3. #2
    تاريخ التسجيل
    Jul 2008
    الدولة
    فلسطبن
    المشاركات
    15
    شي رائع جدا والله

  4. الأعضاء الذين قالوا شكراً لـ mohammed dakka على المشاركة المفيدة:

    sonuci_2010 (23-12-2009)

  5. #3
    تاريخ التسجيل
    Jun 2008
    الدولة
    uae
    المشاركات
    7
    جزاك الله خير سويتلنا REFRESH للمعلومات

  6. الأعضاء الذين قالوا شكراً لـ bio_girl على المشاركة المفيدة:

    sonuci_2010 (23-12-2009)

  7. #4
    تاريخ التسجيل
    Oct 2007
    الدولة
    سوريا
    المشاركات
    9
    واااو
    جد موضوع راااائع
    بتعرف هالمعلومات اجت بوقتا الي
    لانو عندي السنة الجاية عملي بال PCR
    جد شكرا كتير والله يجزيك الخير
    التعديل الأخير تم بواسطة mazon.biotec ; 20-07-2008 الساعة 02:23 AM

  8. الأعضاء الذين قالوا شكراً لـ mazon.biotec على المشاركة المفيدة:

    sonuci_2010 (23-12-2009)

  9. #5
    تاريخ التسجيل
    Aug 2008
    الدولة
    libya
    المشاركات
    678
    ماشاء الله محمد لامين ولا الجنقه هذا
    تشكر اخى على هاذ الموضوع
    http://upload.wikimedia.org/wikipedi.../76/Mendel.png
    يمضى الزمان ويذكر التاريخ أفضل الاعمال

  10. الأعضاء الذين قالوا شكراً لـ المهدى الأمين على المشاركة المفيدة:

    sonuci_2010 (23-12-2009)

  11. #6
    تاريخ التسجيل
    Aug 2008
    الدولة
    ksa
    المشاركات
    1
    ماشاء الله لاقوة الا بالله
    الله يعطيك العافية على هذه المعلومات :sm183:

  12. الأعضاء الذين قالوا شكراً لـ rdad2004 على المشاركة المفيدة:

    sonuci_2010 (23-12-2009)

  13. #7
    تاريخ التسجيل
    Aug 2007
    الدولة
    KSA
    المشاركات
    775
    تسلم يمينك اخي

    موضووع رائع جدا تستحق الشكر
    - من جن بالحب فهو عاقل ومن جن بغيره فهو مجنون

    -إذا أحبك مليون فأنا معهم.. وإذا أحبك واحد فهو أنا ..وإذا لم يحبك أحد فاعلم أنني مت.:sm184:.

  14. الأعضاء الذين قالوا شكراً لـ سليمان العبسي على المشاركة المفيدة:

    sonuci_2010 (23-12-2009)

  15. #8
    تاريخ التسجيل
    May 2008
    الدولة
    الكون .. الوسيع ..
    المشاركات
    128
    تسلم يمناك
    الموضوع رائع

  16. الأعضاء الذين قالوا شكراً لـ خريجة مايكرو على المشاركة المفيدة:

    sonuci_2010 (23-12-2009)

  17. #9
    تاريخ التسجيل
    Aug 2008
    الدولة
    السعودية
    المشاركات
    7
    احسنت الموضوع ممتاز جدا جدا , وانصح الزملاء بالاهتمام بتقنيات البي سي ار , لانها المختبرات القادمة انشاء الله . زادك الله تعالى علما وعملا .
    ويبقى الامل

  18. الأعضاء الذين قالوا شكراً لـ Ali Emam على المشاركة المفيدة:

    sonuci_2010 (23-12-2009)

  19. #10
    تاريخ التسجيل
    Nov 2007
    الدولة
    ksa
    المشاركات
    4
    شكراً ع المعلومات الرائعة

    العمل في وحدة PCR احلى ما حصللي في شهر رمضان

    يا رب يسعفني وقتي و استمر فيها


  20. 2 أعضاء قالوا شكراً لـ ميساء على المشاركة المفيدة:

    Adviser (03-01-2011), sonuci_2010 (23-12-2009)

صفحة 1 من 15 12311 ... الأخيرةالأخيرة

معلومات الموضوع

الأعضاء الذين يشاهدون هذا الموضوع

الذين يشاهدون الموضوع الآن: 1 (0 من الأعضاء و 1 زائر)

ضوابط المشاركة

  • لا تستطيع إضافة مواضيع جديدة
  • لا تستطيع الرد على المواضيع
  • لا تستطيع إرفاق ملفات
  • لا تستطيع تعديل مشاركاتك
  •  
vBulletin skin developed by VillaARTS.